ID: 1110540600

View in Genome Browser
Species Human (GRCh38)
Location 13:76702651-76702673
Sequence ATATGCAGAGATTCGTAGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110540598_1110540600 0 Left 1110540598 13:76702628-76702650 CCATAAATTAAAAAAAAAAAAGA No data
Right 1110540600 13:76702651-76702673 ATATGCAGAGATTCGTAGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110540600 Original CRISPR ATATGCAGAGATTCGTAGTA GGG Intergenic
No off target data available for this crispr