ID: 1110541882

View in Genome Browser
Species Human (GRCh38)
Location 13:76715216-76715238
Sequence GAGTTGCAATTTGAGTTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110541882_1110541887 1 Left 1110541882 13:76715216-76715238 CCTACCAACTCAAATTGCAACTC No data
Right 1110541887 13:76715240-76715262 CAATTGCAACTGAACTATCTGGG No data
1110541882_1110541888 28 Left 1110541882 13:76715216-76715238 CCTACCAACTCAAATTGCAACTC No data
Right 1110541888 13:76715267-76715289 ACAACAAGTTCCTAACACACCGG No data
1110541882_1110541886 0 Left 1110541882 13:76715216-76715238 CCTACCAACTCAAATTGCAACTC No data
Right 1110541886 13:76715239-76715261 CCAATTGCAACTGAACTATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110541882 Original CRISPR GAGTTGCAATTTGAGTTGGT AGG (reversed) Intergenic
No off target data available for this crispr