ID: 1110542565

View in Genome Browser
Species Human (GRCh38)
Location 13:76722460-76722482
Sequence CTGTTTCCTCAGTTGAAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110542563_1110542565 15 Left 1110542563 13:76722422-76722444 CCAATTTTTAAAAATCAAGTCTA No data
Right 1110542565 13:76722460-76722482 CTGTTTCCTCAGTTGAAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110542565 Original CRISPR CTGTTTCCTCAGTTGAAACA AGG Intergenic
No off target data available for this crispr