ID: 1110548063

View in Genome Browser
Species Human (GRCh38)
Location 13:76779038-76779060
Sequence ACCCATATAAAGCAACTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110548059_1110548063 28 Left 1110548059 13:76778987-76779009 CCTAAACTCTCAACATCTAGCAA No data
Right 1110548063 13:76779038-76779060 ACCCATATAAAGCAACTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110548063 Original CRISPR ACCCATATAAAGCAACTGCA AGG Intergenic
No off target data available for this crispr