ID: 1110551611

View in Genome Browser
Species Human (GRCh38)
Location 13:76816804-76816826
Sequence ATTGTCAAGCCCACTGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110551602_1110551611 26 Left 1110551602 13:76816755-76816777 CCGGCCACGTGTCTTGGCTTCCC No data
Right 1110551611 13:76816804-76816826 ATTGTCAAGCCCACTGAGCAGGG No data
1110551605_1110551611 6 Left 1110551605 13:76816775-76816797 CCCTGCCTTTGGTGTGTACTCTG No data
Right 1110551611 13:76816804-76816826 ATTGTCAAGCCCACTGAGCAGGG No data
1110551603_1110551611 22 Left 1110551603 13:76816759-76816781 CCACGTGTCTTGGCTTCCCTGCC No data
Right 1110551611 13:76816804-76816826 ATTGTCAAGCCCACTGAGCAGGG No data
1110551606_1110551611 5 Left 1110551606 13:76816776-76816798 CCTGCCTTTGGTGTGTACTCTGT No data
Right 1110551611 13:76816804-76816826 ATTGTCAAGCCCACTGAGCAGGG No data
1110551607_1110551611 1 Left 1110551607 13:76816780-76816802 CCTTTGGTGTGTACTCTGTGTCC No data
Right 1110551611 13:76816804-76816826 ATTGTCAAGCCCACTGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110551611 Original CRISPR ATTGTCAAGCCCACTGAGCA GGG Intergenic
No off target data available for this crispr