ID: 1110552143

View in Genome Browser
Species Human (GRCh38)
Location 13:76821986-76822008
Sequence AGCAAGAGCAGGAGCAGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110552143_1110552152 25 Left 1110552143 13:76821986-76822008 CCCTCTCTGCTCCTGCTCTTGCT No data
Right 1110552152 13:76822034-76822056 CTCGCTTTCCACTCTGCTTCAGG No data
1110552143_1110552146 -5 Left 1110552143 13:76821986-76822008 CCCTCTCTGCTCCTGCTCTTGCT No data
Right 1110552146 13:76822004-76822026 TTGCTTCCCATCCTTGATCACGG No data
1110552143_1110552147 -4 Left 1110552143 13:76821986-76822008 CCCTCTCTGCTCCTGCTCTTGCT No data
Right 1110552147 13:76822005-76822027 TGCTTCCCATCCTTGATCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110552143 Original CRISPR AGCAAGAGCAGGAGCAGAGA GGG (reversed) Intergenic
No off target data available for this crispr