ID: 1110552145

View in Genome Browser
Species Human (GRCh38)
Location 13:76821997-76822019
Sequence CAAGGATGGGAAGCAAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110552145_1110552152 14 Left 1110552145 13:76821997-76822019 CCTGCTCTTGCTTCCCATCCTTG No data
Right 1110552152 13:76822034-76822056 CTCGCTTTCCACTCTGCTTCAGG No data
1110552145_1110552154 30 Left 1110552145 13:76821997-76822019 CCTGCTCTTGCTTCCCATCCTTG No data
Right 1110552154 13:76822050-76822072 CTTCAGGCACTAAACCACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110552145 Original CRISPR CAAGGATGGGAAGCAAGAGC AGG (reversed) Intergenic
No off target data available for this crispr