ID: 1110552145 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 13:76821997-76822019 |
Sequence | CAAGGATGGGAAGCAAGAGC AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1110552145_1110552152 | 14 | Left | 1110552145 | 13:76821997-76822019 | CCTGCTCTTGCTTCCCATCCTTG | No data | ||
Right | 1110552152 | 13:76822034-76822056 | CTCGCTTTCCACTCTGCTTCAGG | No data | ||||
1110552145_1110552154 | 30 | Left | 1110552145 | 13:76821997-76822019 | CCTGCTCTTGCTTCCCATCCTTG | No data | ||
Right | 1110552154 | 13:76822050-76822072 | CTTCAGGCACTAAACCACAGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1110552145 | Original CRISPR | CAAGGATGGGAAGCAAGAGC AGG (reversed) | Intergenic | ||