ID: 1110552147

View in Genome Browser
Species Human (GRCh38)
Location 13:76822005-76822027
Sequence TGCTTCCCATCCTTGATCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110552140_1110552147 16 Left 1110552140 13:76821966-76821988 CCTGTCTGTGATTCCCACTTCCC No data
Right 1110552147 13:76822005-76822027 TGCTTCCCATCCTTGATCACGGG No data
1110552144_1110552147 -5 Left 1110552144 13:76821987-76822009 CCTCTCTGCTCCTGCTCTTGCTT No data
Right 1110552147 13:76822005-76822027 TGCTTCCCATCCTTGATCACGGG No data
1110552141_1110552147 3 Left 1110552141 13:76821979-76822001 CCCACTTCCCTCTCTGCTCCTGC No data
Right 1110552147 13:76822005-76822027 TGCTTCCCATCCTTGATCACGGG No data
1110552143_1110552147 -4 Left 1110552143 13:76821986-76822008 CCCTCTCTGCTCCTGCTCTTGCT No data
Right 1110552147 13:76822005-76822027 TGCTTCCCATCCTTGATCACGGG No data
1110552139_1110552147 21 Left 1110552139 13:76821961-76821983 CCTTACCTGTCTGTGATTCCCAC No data
Right 1110552147 13:76822005-76822027 TGCTTCCCATCCTTGATCACGGG No data
1110552142_1110552147 2 Left 1110552142 13:76821980-76822002 CCACTTCCCTCTCTGCTCCTGCT No data
Right 1110552147 13:76822005-76822027 TGCTTCCCATCCTTGATCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110552147 Original CRISPR TGCTTCCCATCCTTGATCAC GGG Intergenic
No off target data available for this crispr