ID: 1110552149

View in Genome Browser
Species Human (GRCh38)
Location 13:76822011-76822033
Sequence AAAGGTCCCGTGATCAAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110552149_1110552152 0 Left 1110552149 13:76822011-76822033 CCATCCTTGATCACGGGACCTTT No data
Right 1110552152 13:76822034-76822056 CTCGCTTTCCACTCTGCTTCAGG No data
1110552149_1110552154 16 Left 1110552149 13:76822011-76822033 CCATCCTTGATCACGGGACCTTT No data
Right 1110552154 13:76822050-76822072 CTTCAGGCACTAAACCACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110552149 Original CRISPR AAAGGTCCCGTGATCAAGGA TGG (reversed) Intergenic
No off target data available for this crispr