ID: 1110552152

View in Genome Browser
Species Human (GRCh38)
Location 13:76822034-76822056
Sequence CTCGCTTTCCACTCTGCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110552148_1110552152 1 Left 1110552148 13:76822010-76822032 CCCATCCTTGATCACGGGACCTT No data
Right 1110552152 13:76822034-76822056 CTCGCTTTCCACTCTGCTTCAGG No data
1110552144_1110552152 24 Left 1110552144 13:76821987-76822009 CCTCTCTGCTCCTGCTCTTGCTT No data
Right 1110552152 13:76822034-76822056 CTCGCTTTCCACTCTGCTTCAGG No data
1110552143_1110552152 25 Left 1110552143 13:76821986-76822008 CCCTCTCTGCTCCTGCTCTTGCT No data
Right 1110552152 13:76822034-76822056 CTCGCTTTCCACTCTGCTTCAGG No data
1110552145_1110552152 14 Left 1110552145 13:76821997-76822019 CCTGCTCTTGCTTCCCATCCTTG No data
Right 1110552152 13:76822034-76822056 CTCGCTTTCCACTCTGCTTCAGG No data
1110552149_1110552152 0 Left 1110552149 13:76822011-76822033 CCATCCTTGATCACGGGACCTTT No data
Right 1110552152 13:76822034-76822056 CTCGCTTTCCACTCTGCTTCAGG No data
1110552150_1110552152 -4 Left 1110552150 13:76822015-76822037 CCTTGATCACGGGACCTTTCTCG No data
Right 1110552152 13:76822034-76822056 CTCGCTTTCCACTCTGCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110552152 Original CRISPR CTCGCTTTCCACTCTGCTTC AGG Intergenic
No off target data available for this crispr