ID: 1110552154

View in Genome Browser
Species Human (GRCh38)
Location 13:76822050-76822072
Sequence CTTCAGGCACTAAACCACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110552149_1110552154 16 Left 1110552149 13:76822011-76822033 CCATCCTTGATCACGGGACCTTT No data
Right 1110552154 13:76822050-76822072 CTTCAGGCACTAAACCACAGAGG No data
1110552148_1110552154 17 Left 1110552148 13:76822010-76822032 CCCATCCTTGATCACGGGACCTT No data
Right 1110552154 13:76822050-76822072 CTTCAGGCACTAAACCACAGAGG No data
1110552151_1110552154 -2 Left 1110552151 13:76822029-76822051 CCTTTCTCGCTTTCCACTCTGCT No data
Right 1110552154 13:76822050-76822072 CTTCAGGCACTAAACCACAGAGG No data
1110552145_1110552154 30 Left 1110552145 13:76821997-76822019 CCTGCTCTTGCTTCCCATCCTTG No data
Right 1110552154 13:76822050-76822072 CTTCAGGCACTAAACCACAGAGG No data
1110552150_1110552154 12 Left 1110552150 13:76822015-76822037 CCTTGATCACGGGACCTTTCTCG No data
Right 1110552154 13:76822050-76822072 CTTCAGGCACTAAACCACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110552154 Original CRISPR CTTCAGGCACTAAACCACAG AGG Intergenic