ID: 1110558405

View in Genome Browser
Species Human (GRCh38)
Location 13:76885746-76885768
Sequence GCTGCTGGGGCGCCCCGAGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 4, 3: 26, 4: 259}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110558382_1110558405 23 Left 1110558382 13:76885700-76885722 CCCTCCTTGTGCACCCCGCGCCG 0: 1
1: 0
2: 0
3: 3
4: 63
Right 1110558405 13:76885746-76885768 GCTGCTGGGGCGCCCCGAGGCGG 0: 1
1: 0
2: 4
3: 26
4: 259
1110558394_1110558405 3 Left 1110558394 13:76885720-76885742 CCGCGAGGGCGGCGGCCCCGGGC 0: 1
1: 0
2: 6
3: 31
4: 328
Right 1110558405 13:76885746-76885768 GCTGCTGGGGCGCCCCGAGGCGG 0: 1
1: 0
2: 4
3: 26
4: 259
1110558389_1110558405 10 Left 1110558389 13:76885713-76885735 CCCCGCGCCGCGAGGGCGGCGGC 0: 1
1: 1
2: 3
3: 40
4: 268
Right 1110558405 13:76885746-76885768 GCTGCTGGGGCGCCCCGAGGCGG 0: 1
1: 0
2: 4
3: 26
4: 259
1110558383_1110558405 22 Left 1110558383 13:76885701-76885723 CCTCCTTGTGCACCCCGCGCCGC 0: 1
1: 0
2: 0
3: 12
4: 114
Right 1110558405 13:76885746-76885768 GCTGCTGGGGCGCCCCGAGGCGG 0: 1
1: 0
2: 4
3: 26
4: 259
1110558390_1110558405 9 Left 1110558390 13:76885714-76885736 CCCGCGCCGCGAGGGCGGCGGCC 0: 1
1: 0
2: 4
3: 31
4: 269
Right 1110558405 13:76885746-76885768 GCTGCTGGGGCGCCCCGAGGCGG 0: 1
1: 0
2: 4
3: 26
4: 259
1110558384_1110558405 19 Left 1110558384 13:76885704-76885726 CCTTGTGCACCCCGCGCCGCGAG 0: 1
1: 0
2: 0
3: 8
4: 54
Right 1110558405 13:76885746-76885768 GCTGCTGGGGCGCCCCGAGGCGG 0: 1
1: 0
2: 4
3: 26
4: 259
1110558391_1110558405 8 Left 1110558391 13:76885715-76885737 CCGCGCCGCGAGGGCGGCGGCCC 0: 1
1: 0
2: 3
3: 19
4: 196
Right 1110558405 13:76885746-76885768 GCTGCTGGGGCGCCCCGAGGCGG 0: 1
1: 0
2: 4
3: 26
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110558405 Original CRISPR GCTGCTGGGGCGCCCCGAGG CGG Exonic
900146025 1:1158951-1158973 GCTGCTGGAGGACCCCGAGCTGG - Intergenic
900222973 1:1519112-1519134 CCTGCTGGGGCTCCGCGGGGTGG + Intronic
900237519 1:1599871-1599893 GCTGCCCGAGGGCCCCGAGGCGG - Exonic
900243394 1:1627186-1627208 GCTGCGGAGGCGCCCAGAGCAGG + Exonic
900255047 1:1693486-1693508 GCTGGTGGCGCGCTCCGGGGCGG + Intronic
900263790 1:1746752-1746774 GCTGGTGGCGCGCTCCGGGGCGG + Intergenic
900287523 1:1908788-1908810 GCTGCCACTGCGCCCCGAGGTGG + Intergenic
900625023 1:3604056-3604078 GCTGCTGTGGCACCCAGAGGAGG + Intronic
900653327 1:3742093-3742115 GCTGCTGTGGGGACCTGAGGAGG + Intergenic
902611743 1:17601992-17602014 GCTGCTGGGGAGACCTGAGGTGG - Intronic
903576890 1:24344901-24344923 GCTGCTGGGTCCTGCCGAGGGGG - Exonic
904500092 1:30908448-30908470 GCTGGCGGGGCGCGCCGCGGGGG - Exonic
904696756 1:32335642-32335664 GCTGCTGGGCCACGCCAAGGGGG - Intronic
905685046 1:39901850-39901872 GCTGCCGGGCTGCCCCGAGCCGG - Exonic
905862568 1:41361282-41361304 GCGGCGGGGTCGCCCCGAGCTGG + Intergenic
905960699 1:42040258-42040280 GCTGCTGGAGTGCCAGGAGGAGG + Intergenic
906152847 1:43598028-43598050 GGTGCTGGTGCGCACCGATGAGG + Exonic
906903609 1:49864857-49864879 GCTGCTGGGGCGAGGGGAGGCGG + Intronic
908536050 1:65078376-65078398 GCTGCTTGGGGGCGCTGAGGTGG + Intergenic
908703873 1:66930192-66930214 CCAGCCGGGGCGCCGCGAGGGGG + Intronic
908825964 1:68132898-68132920 GCTGCTGGAGCCCCGGGAGGTGG + Intronic
914958828 1:152188727-152188749 GCTGTTGGGGCGAACCAAGGTGG + Intergenic
915168601 1:153962667-153962689 CCTGGTGTGGCGCCCCGAGGCGG - Exonic
915325277 1:155078791-155078813 GCTTCGGGGGCGCGCCCAGGAGG + Intergenic
917141811 1:171842137-171842159 GGGGCTGGCGCGCACCGAGGGGG - Intronic
919103543 1:193122158-193122180 GCAGCGGCGGCGCCCCGAGCCGG + Exonic
919784731 1:201251994-201252016 GCTGATGGGGGGCTCCAAGGTGG + Intergenic
920681640 1:208077482-208077504 GCTGCTGGGGCTGGCAGAGGCGG + Intronic
922703326 1:227775048-227775070 GCCGCGGGGGCGTCCTGAGGAGG + Intronic
922729412 1:227942074-227942096 GCTGCTGGGGTGGCCCGGGCTGG - Intronic
923055883 1:230425896-230425918 GCGGCGGGGGCGCGCGGAGGAGG - Intergenic
924436869 1:244049435-244049457 GCTGCAGTGGCGCCCGGGGGAGG + Intronic
1063663164 10:8047585-8047607 GCTGCTGGGCTGACCCGAGCTGG + Intergenic
1064230696 10:13528183-13528205 GCCCCGGAGGCGCCCCGAGGAGG + Intronic
1064466280 10:15585430-15585452 GCCGCTGGGGCGCCCCCTAGCGG - Intronic
1065168598 10:23005946-23005968 AATGCTGGGGAGCCCTGAGGTGG + Intronic
1065188877 10:23192986-23193008 GCGGCGGGTGCGCTCCGAGGCGG + Exonic
1067735735 10:48848766-48848788 ACTGCTGTGGCACCCCGAGGAGG + Intronic
1068291499 10:55007113-55007135 GCTTCTGGGGAGTCCTGAGGAGG - Intronic
1072690570 10:97570217-97570239 GCTGCTGGAGCACACGGAGGAGG + Exonic
1073403578 10:103277742-103277764 GCTGCGGGCGCGCTGCGAGGAGG + Exonic
1076796635 10:132801556-132801578 GTGGCTGGGGCTCTCCGAGGTGG + Intergenic
1077122314 11:915299-915321 GCTGATGCTGAGCCCCGAGGTGG + Intergenic
1077303498 11:1857566-1857588 ACTGCTGGGGCGGCGGGAGGGGG + Intronic
1077521830 11:3040867-3040889 GCTGCAGGGACACCCCGCGGTGG + Intronic
1079233630 11:18671360-18671382 GGGGCTGGAGGGCCCCGAGGAGG + Intergenic
1083728848 11:64642653-64642675 GCTGCTGGGGGCGGCCGAGGGGG - Intronic
1084264447 11:67997659-67997681 GCTGCTGGTGCGGCCCGGGATGG - Exonic
1084274307 11:68043856-68043878 GCTGCTGCAGGGCCCCGAGGCGG - Exonic
1084362383 11:68677466-68677488 GCAGCTGGGGGGCCACAAGGAGG - Intergenic
1085515047 11:77106926-77106948 TCTGCTGGGCCGCTCTGAGGTGG - Intronic
1088640832 11:111871374-111871396 GCTGCTGGGCAGCCGAGAGGCGG - Intronic
1088679467 11:112226636-112226658 GCTGCTGGGGCGACGCGCGCTGG + Intronic
1089543452 11:119205339-119205361 GCTGCTGGCTCCGCCCGAGGGGG - Intergenic
1090199907 11:124846479-124846501 GCAGCTGGGTCACCCCGGGGAGG - Intergenic
1090363189 11:126187194-126187216 GCTGCTGGGCCTCCCCTAAGAGG + Intergenic
1091250715 11:134141680-134141702 GCTGGTGGGGGGCCCCAAGCTGG + Intronic
1091549945 12:1529975-1529997 GCTCCTTGGGCGCCCCGAGGGGG + Intronic
1092861938 12:12725811-12725833 CCTGCTTCGGCGGCCCGAGGTGG + Intergenic
1092931568 12:13320654-13320676 GCTGCTCGGGAGGCCTGAGGTGG + Intergenic
1096473015 12:51890681-51890703 GCTGCTGAGGCGGCCCCAAGTGG + Exonic
1096670876 12:53197649-53197671 GCTGCTGGGGCTCCCCTAGGGGG + Exonic
1097246755 12:57611402-57611424 GCCGCGGGGCCGCCACGAGGCGG - Intronic
1100433219 12:94548738-94548760 GCTGGTGGGCAGCCCCCAGGAGG + Intergenic
1102145059 12:110648905-110648927 GCAGCTGGGGCACACAGAGGAGG + Exonic
1103919012 12:124389833-124389855 GCTGCAGGGGCTCTCGGAGGAGG - Intronic
1104301539 12:127569377-127569399 GCTGCTAGGGTGCCTGGAGGGGG - Intergenic
1104602421 12:130162547-130162569 GCTGTGGGGGCGCCGCGAGCTGG + Exonic
1105249111 13:18680596-18680618 GCAGGTGGGGGCCCCCGAGGAGG + Intergenic
1107123495 13:36819725-36819747 GCAGCGGGGGCGCCCGGAGGCGG + Exonic
1108409199 13:50130259-50130281 GCAGCTGGGGAGCCTCGCGGTGG + Intronic
1108478374 13:50843214-50843236 GCTGCTGGGGCCCCTCCAGCAGG - Exonic
1110119597 13:71865762-71865784 GCGGCTGGCGAGCCCCGAGCAGG + Intronic
1110318183 13:74134261-74134283 GCTGCCGGCGAGCCCCGGGGTGG + Intergenic
1110558405 13:76885746-76885768 GCTGCTGGGGCGCCCCGAGGCGG + Exonic
1113795245 13:113053454-113053476 GCTTCTGGGGCAGCCCGTGGAGG + Intronic
1118312793 14:64705539-64705561 CCTGCTGGGGCCCCCAGAGCAGG - Intronic
1121714943 14:96067124-96067146 GGTGCTGGGGTGCCCAGAAGGGG + Intronic
1122855912 14:104559990-104560012 GTTGCTGGGGGGCCCCTGGGTGG - Intronic
1124500474 15:30223401-30223423 GCTGCAGGAGCGCGCCGAAGTGG - Intergenic
1124743100 15:32315266-32315288 GCTGCAGGAGCGCGCCGAAGTGG + Intergenic
1124971610 15:34495022-34495044 CCTGGTGGCGCGCCCCGAGCCGG + Intergenic
1129853771 15:78810600-78810622 GCTGCTGGCGCGGCCCCTGGCGG - Intronic
1130707415 15:86246346-86246368 GTTGCTGGGGAGCCTGGAGGTGG + Intronic
1132398118 15:101489210-101489232 GCGGCCGGGGCGCCCTGCGGGGG - Intronic
1132575007 16:660212-660234 GGTGCTGGGGAGCCCTGCGGGGG - Intronic
1132873031 16:2124034-2124056 GCTGCTGGGGCACCACTGGGTGG + Intronic
1133034472 16:3027235-3027257 GCTTCTGTGGCGCCCGGATGGGG - Exonic
1134552119 16:15143213-15143235 GCTGCTGGGGCACCACTGGGTGG + Intergenic
1135497650 16:22966475-22966497 GCTGCTGGGGAGTGTCGAGGAGG - Intergenic
1136111134 16:28064026-28064048 CCTGCTGGGGCTCCCCAAGAGGG + Intergenic
1138453992 16:57110755-57110777 GCTGCTGGGGCACCCCCACTGGG - Exonic
1138478210 16:57284414-57284436 GCAGCATGAGCGCCCCGAGGCGG + Exonic
1138547060 16:57726208-57726230 GTTCCTGCGGCGCACCGAGGTGG + Exonic
1140025800 16:71289348-71289370 GCGGCTGCGGGGCCCGGAGGTGG - Exonic
1141699688 16:85636673-85636695 GCTGCTGGGCCTTCCCGGGGGGG + Intronic
1141829244 16:86500499-86500521 GCTGGTGGGGCCTCCCCAGGAGG + Intergenic
1142127421 16:88417117-88417139 TCTGCTGGGCCTCCCCCAGGAGG + Intergenic
1142429728 16:90019529-90019551 GCTGGGGGGGCGCCGGGAGGGGG - Intronic
1142432333 16:90036493-90036515 GCTGATGCAGCGCCACGAGGAGG + Exonic
1142501741 17:336881-336903 GGTGCTGGGCCACCCCCAGGTGG - Intronic
1142698984 17:1648459-1648481 GCAGCTCGGGCGCCCCTCGGAGG - Exonic
1144703531 17:17353310-17353332 CCTGCTGGGGCTGCCCTAGGCGG + Intergenic
1144778211 17:17795420-17795442 GCTGCTGCAGTGCCCCGAGGTGG + Exonic
1145089883 17:19977766-19977788 GCTGCCTGGGCATCCCGAGGAGG - Exonic
1145390635 17:22453305-22453327 CCTGCCAGGGTGCCCCGAGGTGG - Intergenic
1146352999 17:32111531-32111553 GGTGCTGTGGCGCCCCCAGCAGG + Intergenic
1147159394 17:38561660-38561682 GCGGCTGGGCGGCCCCGAGTAGG + Exonic
1148132984 17:45273607-45273629 GCTGCCAGGCCGCCCCGGGGAGG + Exonic
1148442411 17:47718334-47718356 GCAGCTGGGCAGCCCCAAGGAGG + Intergenic
1148957164 17:51363375-51363397 GCTGCTGGGGCCACGCGGGGGGG + Intergenic
1149441189 17:56675505-56675527 CCTGCTGGGGTGGCCAGAGGGGG - Intergenic
1149610535 17:57955342-57955364 GCGGCTGGGGCGCGGGGAGGCGG + Intergenic
1149614771 17:57988346-57988368 GCAGCGGGGACGCCCAGAGGGGG - Intergenic
1150666879 17:67148131-67148153 ACTGCTGGGGGGCCGGGAGGGGG + Intronic
1151543311 17:74776432-74776454 GCTGATTGGGCGCCTCGCGGGGG - Intergenic
1151815295 17:76468710-76468732 AAAGCTGGGGCGCCCCAAGGAGG + Exonic
1152240594 17:79158873-79158895 GCTGCTGGGACTCCCAGAGATGG + Intronic
1152387010 17:79980723-79980745 GCTGTTGGGGTGCGCGGAGGCGG - Intronic
1152526188 17:80889509-80889531 GCTGCTGGGGAGCCCTCAGGGGG + Intronic
1152635360 17:81428591-81428613 GCTGCTGGGGTCCCCCAGGGTGG - Intronic
1152848279 17:82615894-82615916 GGTGCTGTGGCGCCCCCAGCTGG + Exonic
1152861235 17:82698069-82698091 GCTGCTGTGGGGACCCGGGGCGG - Intronic
1154439774 18:14378634-14378656 GCAGGTGGGGGCCCCCGAGGAGG - Intergenic
1160234819 18:77077631-77077653 GATGCTGGGCCGGCCCGGGGCGG + Intronic
1160426146 18:78780499-78780521 GCTGCCGGGGAGCTGCGAGGAGG - Intergenic
1160533934 18:79581148-79581170 GCATCTGGGGTGCCCCGTGGGGG + Intergenic
1160621141 18:80171397-80171419 GCTGCTGTGGCGCCCCCTGCTGG - Exonic
1160696799 19:488887-488909 GCAGCCGGGGCGCCCCGCAGTGG + Intergenic
1160729684 19:635505-635527 CCCGCTGGGGCACCCTGAGGTGG - Intergenic
1160795660 19:944304-944326 GCTGCAGGGGCGCGTCCAGGGGG + Intronic
1160904470 19:1445942-1445964 GAGGCTGGGGGGGCCCGAGGCGG - Intergenic
1160991957 19:1863721-1863743 GTGGCTGCGGCGCCCCGAGGGGG - Intergenic
1161107897 19:2453686-2453708 GCTGCTGCGGCCCCGAGAGGTGG + Intronic
1161215753 19:3094453-3094475 GCGGCTGGCGCGGCCCGAGCGGG + Exonic
1161699624 19:5787642-5787664 GCTGCTGAGCCGCACCGTGGAGG - Exonic
1162473402 19:10885849-10885871 GCTGCTGTGGCTCCCTGTGGGGG - Intronic
1162517214 19:11155668-11155690 GCTGCTGGGGCGCCACGAGCAGG - Exonic
1163639009 19:18451087-18451109 GGTGCTCGGGCGCCCCCATGTGG - Intronic
1165745181 19:38226387-38226409 TCGGCTGGGGCGCCCCCTGGTGG - Intronic
1165871309 19:38975501-38975523 ACAGCTGGGGCGCCCCGGGAAGG - Intronic
1166043825 19:40218034-40218056 GCTGCTGGTGGGCCCGGGGGCGG + Exonic
1166374195 19:42317916-42317938 ACTTCTGGGGAGCCCCGAGAGGG - Intronic
1167212176 19:48140028-48140050 CCTGCTGGGGTGGCCCAAGGTGG + Exonic
1167738669 19:51311684-51311706 GCTGGGGGGGCGCGACGAGGCGG - Intergenic
1168713402 19:58514071-58514093 GCTGCTGGAGCGCCACCTGGCGG - Exonic
926095920 2:10080442-10080464 GCTGCATAGGCGTCCCGAGGGGG + Intronic
926216995 2:10912041-10912063 GCTGCCTGCGCGCCCCGGGGCGG + Exonic
926217061 2:10912247-10912269 CCTGCGGGGGCGCGCCGCGGGGG - Exonic
928990790 2:37231507-37231529 GCGGCCTTGGCGCCCCGAGGAGG - Exonic
930026423 2:47031899-47031921 GCTGATGGGGAGCCACGAGTGGG - Intronic
931566819 2:63622955-63622977 GCTGCTTGGGCGCCGTGCGGTGG - Intronic
932667241 2:73707886-73707908 GCTCTTGGGGCCCCCTGAGGTGG - Intergenic
933779514 2:85791846-85791868 CATGCTGGGGTGGCCCGAGGAGG - Intergenic
934559732 2:95306950-95306972 GCTGCTGGGGAGGCGGGAGGAGG - Intronic
934665627 2:96167999-96168021 TCTGGTGGGGTGCCCCCAGGAGG - Intergenic
937026917 2:118706476-118706498 GCTTCTGGGGAGGCCCCAGGAGG + Intergenic
937128190 2:119487882-119487904 GCTGCTGGGGCTCTCCGTTGAGG - Intronic
944104769 2:196068448-196068470 CCTGCTGGCGCGCCGCTAGGCGG + Intronic
944983220 2:205146013-205146035 GCTGCTGGCGCTTCCCCAGGAGG - Intronic
946197565 2:218044165-218044187 GCTGCTGTGGCACCCAGGGGTGG + Intronic
946285127 2:218697113-218697135 GGTCCTGAGGCTCCCCGAGGAGG + Exonic
946417540 2:219547924-219547946 ACTGCTGGGGCGCTACGTGGTGG + Exonic
948348480 2:237319204-237319226 GCTGCAGGGGAGCACAGAGGCGG - Intergenic
948661298 2:239508144-239508166 GCTGCTGCAGCGCCCTGTGGCGG + Intergenic
948867237 2:240782334-240782356 GCTGCTGGGAGACACCGAGGTGG - Intronic
949000661 2:241610937-241610959 GCTTCTGGGGGTCTCCGAGGGGG + Intronic
1169817676 20:9674972-9674994 GCAGCTGGGGTGGCCCAAGGAGG + Intronic
1170893066 20:20392111-20392133 CCTGCTGGGGCGCCCTGGGTGGG - Intronic
1174342492 20:49906543-49906565 GCTGCTCGGACGCCCTGCGGCGG - Exonic
1175247766 20:57591873-57591895 GCTGCTGGGGCGCCGGGAGGGGG + Intergenic
1175715814 20:61253396-61253418 GCTCCGGGGGCGCCCCTGGGCGG + Intronic
1176073949 20:63240094-63240116 GGCTCTGGGGAGCCCCGAGGCGG - Intronic
1176205492 20:63885924-63885946 TCCCCTGGGGCTCCCCGAGGAGG + Intronic
1176367549 21:6043109-6043131 AGTGCTGTGGCGCCCCGCGGAGG + Intergenic
1176455970 21:6911139-6911161 GCAGGTGGGGGCCCCCGAGGAGG + Intergenic
1176834144 21:13776187-13776209 GCAGGTGGGGGCCCCCGAGGAGG + Intergenic
1177757196 21:25362033-25362055 GCGGCTGGGGGGCCCGGAAGTGG - Intergenic
1178893809 21:36542684-36542706 GCTGCTGGGGGGCCTCTGGGAGG - Intronic
1179483339 21:41692558-41692580 GCTCCAGGGGTGCCCCGATGAGG + Intergenic
1179755970 21:43495433-43495455 AGTGCTGTGGCGCCCCGCGGAGG - Intergenic
1179833292 21:44011998-44012020 GCAGCTCGGGCGTCCCGCGGCGG - Intergenic
1180837233 22:18936014-18936036 GCTGCTGGCGCGCCACGAGCAGG - Exonic
1180841481 22:18960863-18960885 GCTGCTGGCGCGCCCTGAGCAGG + Intergenic
1181015640 22:20066894-20066916 GCTGCTGGGGAGCCCTGGGCAGG - Intergenic
1181060009 22:20277931-20277953 ACTGCTGGTGCGCCCTGAGCGGG - Intronic
1181064729 22:20300011-20300033 GCTGCTGGCGCGCCACGAGCAGG + Intergenic
1181516102 22:23414735-23414757 GCTGCTGGCGCAGCCCAAGGAGG + Intergenic
1181777847 22:25172332-25172354 GCTCCTGGGGTGGCCCGAGGAGG - Intronic
1181793048 22:25282798-25282820 GCTGGTGGGGCGCGCCGAGCAGG + Intergenic
1181813688 22:25421086-25421108 GCTGCTGGGGCGCGCAGAGCGGG + Intergenic
1181989341 22:26825471-26825493 CCTGCTGTGGCTCCCCGACGTGG + Intergenic
1182551920 22:31105216-31105238 GCTGCTGGGCCGCCGCTACGAGG - Exonic
1183308352 22:37096011-37096033 GCTGATGCTGAGCCCCGAGGTGG - Exonic
1184173788 22:42774695-42774717 GCTGCAGGTGCGTCCAGAGGAGG - Intergenic
1184648580 22:45909199-45909221 GCTGCAGGGGCGCAGCCAGGTGG - Intergenic
1184984387 22:48119456-48119478 GGTGCTGTGGCACCCCCAGGTGG - Intergenic
1185278901 22:49961558-49961580 GGTGCTGGAGCGGCCCGAGCCGG + Exonic
1185299686 22:50072882-50072904 GCTGCTGAGGCGCTCAGAGAGGG - Intronic
1203287326 22_KI270734v1_random:161313-161335 GCTGCTGGCGCGCCACGAGCAGG - Intergenic
954138136 3:48591700-48591722 TCTGCTGGAGGGCCACGAGGTGG - Exonic
954302116 3:49705562-49705584 GCTGCTGGGGCGGCCCCCCGAGG + Exonic
954321202 3:49833106-49833128 GCTGCTGTGGTTCCCAGAGGAGG - Intronic
954700782 3:52449884-52449906 GCTGCTGGTGCTGCCCGATGTGG + Intergenic
956168640 3:66415308-66415330 GCTGCTGGGCCACCCCAAGAGGG + Intronic
956277660 3:67520532-67520554 GCTGGTGGGCAGCCCCCAGGGGG - Exonic
956892256 3:73624444-73624466 GCTGCTGCGGCGCGACGTGGAGG - Exonic
957215735 3:77317675-77317697 GCTGCTGGGGGGCTACTAGGGGG + Intronic
957215747 3:77317709-77317731 GCTGCTGGGGGGCTGCTAGGGGG + Intronic
957215776 3:77317778-77317800 GCTGCTGGGGGGCTGCTAGGGGG + Intronic
957215797 3:77317824-77317846 GCTGCTGGGGGGCTGCTAGGGGG + Intronic
957215830 3:77317903-77317925 GCTGCTGGGGGGCTGCTAGGGGG + Intronic
959927663 3:111941881-111941903 GCTGCTGGGGCACCCCAAATGGG - Intronic
960329311 3:116338820-116338842 GCTGCAGTGGCACCCCAAGGTGG + Intronic
961574456 3:127823230-127823252 GCGGCGGGGGCGGCCCGAGGTGG + Intronic
961674316 3:128555530-128555552 GCCGCGGACGCGCCCCGAGGGGG - Intergenic
965521212 3:169669373-169669395 ACAGCTGGAGCGCCCCGGGGAGG + Intergenic
966849492 3:184155815-184155837 GCGGCCGGGGCTCCCGGAGGCGG - Intronic
968008848 3:195260196-195260218 GGTGCAGCGGCGCCCCCAGGCGG + Intronic
968079199 3:195834922-195834944 GGTGCTGGGGCCCCGGGAGGAGG + Intergenic
968619369 4:1596975-1596997 GCTGGAGGGAGGCCCCGAGGAGG - Intergenic
968627178 4:1631218-1631240 GCTGCTGGGAAGCCCCAAGCAGG - Intronic
968820066 4:2843697-2843719 CCGGCGGGGTCGCCCCGAGGCGG + Intergenic
969485104 4:7467783-7467805 GCTGCTGTGGCTCCCGGAGCCGG + Intronic
969663641 4:8544741-8544763 GCTGCTTGGGGGCACTGAGGAGG + Intergenic
976811141 4:89102456-89102478 GCTGCTGGGGGGTGCTGAGGTGG - Intronic
981035632 4:140165645-140165667 GCTACTCGGGAGCCCTGAGGAGG - Intergenic
984888817 4:184473723-184473745 CTTGCTGGGGCGCCCCGCGGCGG - Intronic
985631757 5:1017671-1017693 GCTGCAGGGCGGCCCCGTGGTGG - Intronic
989102381 5:37834998-37835020 GCTCCTGGGGCGCGCTGAGGAGG - Intronic
993134617 5:83943424-83943446 GCTGCTGGGCTGCACAGAGGAGG - Exonic
993898707 5:93570524-93570546 TCTGCTGTGCCGACCCGAGGGGG + Intergenic
994210739 5:97085307-97085329 GCTGCTGGAGCACACCGCGGGGG + Intergenic
996717659 5:126600860-126600882 GCTGCTCGGGCGCCCCCGCGCGG - Exonic
1001070292 5:168579522-168579544 GCTGCGGGGGGGCCCCGGAGCGG - Exonic
1002091832 5:176810648-176810670 GCCCCGGGGGCGCCCCGAGCTGG + Exonic
1002206914 5:177569261-177569283 GCTGCTGGGGCCCCACGGTGTGG + Intergenic
1002252608 5:177939059-177939081 GCTGCTGGGGAGCCTGGAGCTGG + Intergenic
1002691401 5:181053078-181053100 GCTGCGGTGGCGCCCGGAGAAGG + Intronic
1006717714 6:36130824-36130846 GCCGCTGGGTGGCCCCGGGGAGG - Intronic
1007549156 6:42715862-42715884 GTTTCTGGGGGGCCCCAAGGAGG + Intronic
1007651972 6:43428121-43428143 GTTACTTGGGCACCCCGAGGTGG + Exonic
1008487868 6:52054821-52054843 TCTGCAGGGGCGCCCAGTGGAGG - Intronic
1012245898 6:96925084-96925106 GCTGCTGGTGCGCCAAGTGGGGG + Intronic
1014079545 6:117270888-117270910 GCGGGCCGGGCGCCCCGAGGCGG - Exonic
1014570891 6:123006156-123006178 GCTGGTGGCGGGCCCAGAGGAGG + Intronic
1015965468 6:138692710-138692732 GCGGCTGCGCCGGCCCGAGGCGG - Intergenic
1017470555 6:154733800-154733822 GCTGCTGCGTGGCCGCGAGGAGG - Intronic
1019530080 7:1498953-1498975 GGTGCGGGGGCGCCCCGGGGGGG - Exonic
1020012935 7:4816297-4816319 GCTGCAGGTGCACCCCGAGGTGG - Exonic
1020137065 7:5593539-5593561 CCTGGTGGCGCGCCCCGAGCCGG + Exonic
1023986839 7:45101864-45101886 GCTGCTGGGGAGCGCCGACAAGG - Exonic
1023989469 7:45119485-45119507 GCTGAGGGGGCGCCACAAGGAGG - Intergenic
1024638448 7:51309921-51309943 GCAGCTGGGGCTCCCCCAGGAGG - Intronic
1026360368 7:69597833-69597855 GCTGGTGGGGCTTCCCGAGAAGG + Intergenic
1026458922 7:70596310-70596332 GCTGCCCGGGCGTCCAGAGGCGG + Intronic
1026830222 7:73606024-73606046 GCTGCTGGGGGACCCAGAGGAGG - Exonic
1027829751 7:83162684-83162706 GCTGCCTGCACGCCCCGAGGCGG - Exonic
1029248373 7:99218796-99218818 GCTGTTTGGGGGCCCTGAGGAGG - Intergenic
1029270585 7:99374788-99374810 GCCGTGGGGGCGCCCGGAGGTGG + Intronic
1032382942 7:131503239-131503261 GCTGATGGGGGGCCCCGGGAAGG + Intronic
1034347652 7:150397210-150397232 GCCGCGGGGGCGCCCCGAGTGGG + Exonic
1035050947 7:155998850-155998872 GCTGCTGGCGGGCTCCCAGGTGG - Intergenic
1035705157 8:1669580-1669602 GCCGCTGGGGCGGCCCAGGGAGG + Intronic
1039484274 8:37899114-37899136 GTTCCTGGGCCGCGCCGAGGTGG - Exonic
1039542206 8:38381888-38381910 GCCGCTGGGGCCGCGCGAGGAGG + Exonic
1039903078 8:41767008-41767030 GCCGCCGGGGTGCCCCGAGGGGG - Intronic
1042829267 8:73009033-73009055 GCAGGTGGGGGCCCCCGAGGAGG + Exonic
1049021027 8:139957786-139957808 GCTGATGGCTCGGCCCGAGGGGG - Intronic
1049409033 8:142464264-142464286 GCTGCTGGGACGCCGCGCGCGGG + Exonic
1049571137 8:143370798-143370820 GCTGCAGGGGCTCCCGGGGGAGG + Intronic
1049612509 8:143562068-143562090 GCTGCTGGAGGGCCTGGAGGGGG + Exonic
1053784859 9:41646463-41646485 GCTGCTGCCGCGCTCAGAGGTGG - Intergenic
1054160153 9:61667719-61667741 GCTGCTGCCGCGCTCAGAGGTGG + Intergenic
1054448438 9:65389473-65389495 GCTGCTGTCGCGCTCAGAGGTGG - Intergenic
1055302485 9:74896847-74896869 GCTGCAGGGGCTGCCTGAGGAGG - Intergenic
1058588532 9:106535829-106535851 TCTGCTGTGGCGCCCTGAAGAGG - Intergenic
1059119780 9:111631497-111631519 GCTGCTGGTGCGGCCCGCGGGGG + Exonic
1059400921 9:114070483-114070505 GCTCCAGGGGCTCCCAGAGGTGG - Intronic
1060942871 9:127553383-127553405 GCTGCTGAGGCTCCTCCAGGAGG + Intronic
1061893979 9:133637395-133637417 GCTGCAGGGGGTCCCCGAAGTGG + Intronic
1062035078 9:134379387-134379409 GCTTCTGGGGCACCCTGAGATGG + Intronic
1062453284 9:136624420-136624442 GCTGCTGGGAGGCTCCCAGGAGG + Intergenic
1186758057 X:12694008-12694030 TCTGCTGGGGTTCCCTGAGGAGG + Intronic
1189386259 X:40539352-40539374 GTGGGTGGGGCGCCCCCAGGTGG - Intergenic
1192196580 X:69032809-69032831 GCTGCTGCTGCTCCCAGAGGTGG + Intergenic
1192510367 X:71717581-71717603 GCTGCTGGGGATCCACGCGGAGG + Exonic
1192516330 X:71763972-71763994 GCTGCTGGGGATCCACGCGGAGG - Exonic
1197129996 X:122994353-122994375 GCTGCTGTGGCACTCCAAGGGGG - Intergenic
1198424120 X:136497542-136497564 ACTGCTGGGGCGCAGCGGGGAGG + Intronic