ID: 1110560588

View in Genome Browser
Species Human (GRCh38)
Location 13:76907440-76907462
Sequence CTGTAGAAAGGGCTGGTAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110560588_1110560595 -10 Left 1110560588 13:76907440-76907462 CCATTTACCAGCCCTTTCTACAG No data
Right 1110560595 13:76907453-76907475 CTTTCTACAGGCCTGGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110560588 Original CRISPR CTGTAGAAAGGGCTGGTAAA TGG (reversed) Intergenic
No off target data available for this crispr