ID: 1110564695

View in Genome Browser
Species Human (GRCh38)
Location 13:76946513-76946535
Sequence CACCAAATTGTGGCATCTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 104}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110564695_1110564700 18 Left 1110564695 13:76946513-76946535 CCATAAGATGCCACAATTTGGTG 0: 1
1: 0
2: 0
3: 7
4: 104
Right 1110564700 13:76946554-76946576 GACATTGCCCAATGTCCTCTGGG 0: 1
1: 45
2: 253
3: 694
4: 1252
1110564695_1110564699 17 Left 1110564695 13:76946513-76946535 CCATAAGATGCCACAATTTGGTG 0: 1
1: 0
2: 0
3: 7
4: 104
Right 1110564699 13:76946553-76946575 AGACATTGCCCAATGTCCTCTGG 0: 1
1: 48
2: 300
3: 750
4: 1316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110564695 Original CRISPR CACCAAATTGTGGCATCTTA TGG (reversed) Intergenic
901935990 1:12627452-12627474 CACCACATTATGGGATTTTATGG - Intergenic
902626174 1:17677684-17677706 CAGCAACTTGAGTCATCTTACGG + Intronic
903358039 1:22760170-22760192 CACCAAACTGTGGGGTCTTGGGG - Intronic
906237089 1:44218671-44218693 CATCAAATACTGGTATCTTAAGG - Exonic
907954237 1:59213209-59213231 CAACAAACTGTGACATCTTCAGG - Intergenic
909383782 1:75033793-75033815 CACCTAATTTTTGCTTCTTATGG - Intergenic
912993606 1:114511762-114511784 CAGCTATTTTTGGCATCTTAAGG + Intergenic
919293675 1:195666644-195666666 AACCAAATTGTGACCCCTTATGG - Intergenic
921291606 1:213662909-213662931 CACCAATTGGTGGCTACTTATGG - Intergenic
924700869 1:246450622-246450644 CACTAAACTGTGACATCTCAAGG + Intronic
1064934287 10:20662783-20662805 CACCAAATTGTAGAAGCTTTAGG - Intergenic
1065612550 10:27486531-27486553 CACTAAATTGTGCCTTCTTTGGG + Intergenic
1067019901 10:42786214-42786236 CACCAGAATGTGGCTTCATAAGG - Intronic
1068008838 10:51422326-51422348 CACCTAGCTGTGGCATCCTATGG - Intronic
1071315538 10:84392364-84392386 CAGCACATTGTGGAATATTATGG + Intronic
1073477501 10:103763851-103763873 CACAAAACTGTTCCATCTTAGGG - Intronic
1073868591 10:107834195-107834217 TAACAAACTGTGGCAACTTAAGG + Intergenic
1075744702 10:124718709-124718731 CACCAGATTCTTGCCTCTTAAGG + Intronic
1080780898 11:35429177-35429199 CACAAAATTGTGGCCACTGATGG - Intergenic
1083030911 11:59591408-59591430 GACCAAATTGTGGTATCTGCAGG - Intronic
1092651573 12:10640667-10640689 CACCAAATTATGAAATCTGAGGG + Intronic
1099499249 12:83391058-83391080 CACCAATTTGTTGCATCTCACGG - Intergenic
1100967403 12:100027814-100027836 GATAAAATTATGGCATCTTAAGG - Intergenic
1104227202 12:126847066-126847088 CAATAATTTGTGGCTTCTTAGGG + Intergenic
1105997370 13:25685598-25685620 CACCTCAATGTGGCTTCTTAGGG - Intronic
1106007260 13:25782566-25782588 CCACAAATTTTGGCATCTGAAGG - Intronic
1107639908 13:42431375-42431397 AAGCAAATTGTGGCATATTTAGG + Intergenic
1107656833 13:42600019-42600041 CACTAAAATGTCACATCTTAGGG - Intronic
1109594515 13:64532599-64532621 CACAATATTGTGGTATTTTAAGG - Intergenic
1110403547 13:75122292-75122314 CCCCAAAGTGTGGCATTTGAAGG - Intergenic
1110564695 13:76946513-76946535 CACCAAATTGTGGCATCTTATGG - Intergenic
1112532144 13:100215529-100215551 CAACAAATTTTGGTATCTGAGGG - Intronic
1112833931 13:103490595-103490617 CACTAAATTGTGTCTTTTTAGGG - Intergenic
1113527260 13:110990393-110990415 CAGCAAATTATGGTATCTTTTGG - Intergenic
1115616412 14:35099333-35099355 CATCTAATTGTGGCAACGTAGGG + Exonic
1117075292 14:52096428-52096450 CACCAAATAGTATCATATTAGGG - Intergenic
1117187724 14:53258644-53258666 TACCAAATTTTGACACCTTATGG + Intergenic
1118462835 14:66002476-66002498 CACCATCTTGTGGAATCTTAGGG + Intronic
1127190993 15:56530196-56530218 CACCAAAGGGTGGAATCTTCAGG + Intergenic
1127389450 15:58493345-58493367 CACAAAACTGGGGCATCGTAGGG + Intronic
1128358727 15:66945766-66945788 CACCAGATTTGGTCATCTTAGGG - Intergenic
1129547259 15:76409682-76409704 AACCAAATTGTTGCTTATTAGGG + Intronic
1130325278 15:82874645-82874667 CACCACTGTGTGGCATTTTAAGG + Intronic
1132347859 15:101119203-101119225 CCCAAACATGTGGCATCTTAGGG - Intergenic
1133439332 16:5807337-5807359 CACAATCTTGTGGCATCTTCAGG + Intergenic
1139252206 16:65507085-65507107 CACCCATATGTGTCATCTTATGG + Intergenic
1144247691 17:13383902-13383924 CACCAACTTGTGGCATGGGATGG - Intergenic
1150467762 17:65408798-65408820 CACCATACTGTGGCCTATTAAGG + Intergenic
1151001218 17:70379159-70379181 TAACAAATTGTTGCATCTTGTGG - Intergenic
1151104822 17:71600624-71600646 CAGCAATTTGTGGCCTCTTGTGG + Intergenic
1151533711 17:74725151-74725173 CACTAAAATGTGGCAGCCTAGGG + Intronic
1153463769 18:5366186-5366208 CACTAAATTTTGTCATCCTAGGG + Intergenic
1158959011 18:62572398-62572420 CTCCAACTTGTGCCATCTGATGG - Intronic
1166537441 19:43583535-43583557 CAGAAAATTGTGGAATCTCATGG - Intronic
926876299 2:17483356-17483378 TACCAAAATATGGCATGTTAGGG - Intergenic
927289489 2:21391933-21391955 AACCAAATTGTAGGATCATAGGG + Intergenic
932009003 2:67956575-67956597 CACCAAATAGTGGAATCAGATGG + Intergenic
932873484 2:75426980-75427002 CACCTTTTTGTGGCATCTAATGG - Intergenic
939440384 2:142241229-142241251 CAACAGTTTGTGGCATGTTATGG + Intergenic
942874374 2:180776239-180776261 CACCAAATTGTGGGCTGTTCAGG - Intergenic
944982072 2:205132677-205132699 TTCCCAAATGTGGCATCTTAAGG - Intronic
1178029274 21:28505812-28505834 CACCACATTGAAGCAGCTTATGG + Intergenic
1178279162 21:31266144-31266166 CAGCAGCTGGTGGCATCTTATGG + Exonic
1179090543 21:38261253-38261275 CCCCAAATTGTGCAATCTTAAGG - Intronic
1182816083 22:33165214-33165236 CATCAAATTGTGGCTTCTTCAGG - Intronic
1184917562 22:47581318-47581340 CTCCAAATTTTGACACCTTATGG - Intergenic
949988125 3:9555249-9555271 CTCCAAATTGTGGGATTTTATGG - Intergenic
960585890 3:119321462-119321484 CACCAAAATGTTACATCTTTGGG - Intronic
963742369 3:149093287-149093309 CACCAAACTATTGCATCGTATGG + Intergenic
967422680 3:189291233-189291255 CAACAAATTATGGGACCTTAGGG + Intronic
970782987 4:19761404-19761426 CACCAAATCTTAGAATCTTATGG - Intergenic
970841888 4:20482599-20482621 CACCAAAGGGTGACATTTTATGG + Intronic
972414269 4:38823580-38823602 TACCAAATTGTGGCATTGGACGG + Intronic
973738935 4:53901286-53901308 CACCTAATTGCTGCATCTTATGG + Intronic
977981117 4:103323306-103323328 CACTATATTGTGGCCTATTAAGG + Intergenic
985216621 4:187660208-187660230 AACCAAATTTTGGCTTCTCAGGG - Intergenic
993288201 5:86029599-86029621 CACTAAATTATGTCATTTTATGG + Intergenic
994010696 5:94898903-94898925 CAACAAATTGTGGAATTTGAGGG - Intronic
1001335668 5:170794830-170794852 CACCAAATTGTTGAATTTTTTGG - Intronic
1003599424 6:7503454-7503476 CATAGAATTGTGGCATTTTAGGG + Intergenic
1006364692 6:33608467-33608489 CAGCAAAGTGTGGAATCTCAGGG - Intergenic
1006389453 6:33749928-33749950 CTCCGAATGGTGGCATCTAAGGG - Intergenic
1006625498 6:35394831-35394853 CACCAAAATGTTACCTCTTAGGG - Intronic
1012905104 6:105055107-105055129 CACCAAAGTGTGGGATTTTGGGG + Intronic
1019265336 7:113010-113032 ATCCATATTGTGGCATGTTAGGG + Intergenic
1027288973 7:76681446-76681468 CACCAAATTTTGCCTTGTTATGG - Intergenic
1035529431 8:339094-339116 CCCCAAATTGTGGAGTCATAAGG - Intergenic
1036292879 8:7510262-7510284 CTCCAAATTTTGGCAAATTAGGG - Intergenic
1036329682 8:7810746-7810768 CTCCAAATTTTGGCAAATTAGGG + Intergenic
1037196260 8:16194019-16194041 CAGCAATTTGGGGCATCTTTTGG - Intronic
1038235587 8:25750366-25750388 AAGTAAATTGTGGCATGTTAAGG + Intergenic
1041574057 8:59372701-59372723 ATCCAAATTTTGGCCTCTTATGG + Intergenic
1042991526 8:74645804-74645826 TACCAAACTGTGCCATCTAATGG + Intronic
1043153408 8:76746959-76746981 CACCGAATTCTGACATGTTAAGG + Intronic
1043767000 8:84148400-84148422 CACATAAATGTGGAATCTTAGGG - Intergenic
1044910140 8:97048865-97048887 CACAAAAGTGTGCCATATTAAGG - Intronic
1045754592 8:105527821-105527843 GAAGAAAGTGTGGCATCTTATGG + Intronic
1049300060 8:141864836-141864858 CACAACATGGTGGCATCTTCAGG - Intergenic
1051065894 9:13102719-13102741 CACCAATTTTTTGCCTCTTAAGG + Intergenic
1051390351 9:16556897-16556919 CACCAAGTTGTGACAACTTTTGG + Intronic
1054756596 9:68964988-68965010 TGCCAAATGGTGGCAGCTTAAGG - Intronic
1055265246 9:74487737-74487759 CACCAAATTGTAGAATCTCAAGG + Intergenic
1056697338 9:88871185-88871207 AAACAAATGGTAGCATCTTAGGG - Intergenic
1057570491 9:96200760-96200782 TACCTAATTGTGGCTTCTTCAGG + Intergenic
1058400563 9:104613435-104613457 GAGCAAACTGAGGCATCTTAAGG + Intergenic
1186397397 X:9223657-9223679 CACTAAATTGTGACTTCATAGGG - Intergenic
1188465685 X:30477512-30477534 CAACAAATTATGGCATTTAAGGG + Intergenic
1194702726 X:97134294-97134316 TAGCAATTTGTGGCATCTGAAGG - Intronic
1202330981 Y:23752901-23752923 AAGCAAATTGTGTCCTCTTATGG + Intergenic
1202348513 Y:23961352-23961374 AAGCAAATTGTGGCCTCTTGTGG + Intergenic
1202522261 Y:25708752-25708774 AAGCAAATTGTGGCCTCTTGTGG - Intergenic
1202539788 Y:25917160-25917182 AAGCAAATTGTGTCCTCTTATGG - Intergenic