ID: 1110565722

View in Genome Browser
Species Human (GRCh38)
Location 13:76955874-76955896
Sequence CAGGATGAACAGTCAGAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 199}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110565722_1110565726 15 Left 1110565722 13:76955874-76955896 CCTTACTCTGACTGTTCATCCTG 0: 1
1: 0
2: 0
3: 21
4: 199
Right 1110565726 13:76955912-76955934 CAAATGTCGGCCACATCATATGG 0: 1
1: 0
2: 0
3: 7
4: 63
1110565722_1110565723 -9 Left 1110565722 13:76955874-76955896 CCTTACTCTGACTGTTCATCCTG 0: 1
1: 0
2: 0
3: 21
4: 199
Right 1110565723 13:76955888-76955910 TTCATCCTGCAGATAAAAAATGG 0: 1
1: 0
2: 1
3: 24
4: 319
1110565722_1110565725 2 Left 1110565722 13:76955874-76955896 CCTTACTCTGACTGTTCATCCTG 0: 1
1: 0
2: 0
3: 21
4: 199
Right 1110565725 13:76955899-76955921 GATAAAAAATGGTCAAATGTCGG 0: 1
1: 1
2: 8
3: 62
4: 426

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110565722 Original CRISPR CAGGATGAACAGTCAGAGTA AGG (reversed) Intronic
900439103 1:2644491-2644513 CAGGAGGGACAGTCAGTGTGTGG + Intronic
906312910 1:44766689-44766711 GAGGGTGAACAGCCAGGGTATGG + Intronic
906353510 1:45083543-45083565 CAGAAAGAACAGTCAGAGCTGGG - Intronic
907278786 1:53331646-53331668 CAGGATGGAGAGGCAGGGTAGGG - Intergenic
907664913 1:56426219-56426241 CAGGAAGAGGAGTGAGAGTATGG - Intergenic
907686646 1:56618346-56618368 AAGGAGGAAGAGTCAGAGTGAGG + Intronic
910756309 1:90696006-90696028 CAGGATGAAAAGTGATAGAATGG + Intergenic
912542961 1:110430875-110430897 CAGGCTGAAGAGTGAGAGTCAGG - Intergenic
913251289 1:116913615-116913637 CAGGGGAAACAATCAGAGTAGGG - Intronic
915734376 1:158075434-158075456 AAGGATGAACACACAGAGCAGGG + Intronic
917413772 1:174787063-174787085 CAGGATGCAAAGGCAGAGGAGGG + Intronic
918303382 1:183224196-183224218 CAGGGAGAAAAGTCAGAGAAGGG + Intronic
919007539 1:191917881-191917903 TTGGATGAATAGTCAGAGTGAGG + Intergenic
920305413 1:205015311-205015333 CAGGATGAGCAGTGGGAGTCTGG - Intronic
920928761 1:210367425-210367447 CAGTGTGTAGAGTCAGAGTAGGG + Intronic
921760301 1:218905990-218906012 CAGGATAAAGAGGCAGAGAATGG - Intergenic
924827499 1:247556177-247556199 CAGAATCAAAAGTCAGACTATGG + Intronic
1063296240 10:4809672-4809694 CGGGATGAACAGACAGATGAAGG + Intronic
1063554700 10:7067141-7067163 CTGGAAGAACAGTGAGAGTTAGG + Intergenic
1064489164 10:15831998-15832020 CAGGACTAACAGTCAGAATGAGG - Intronic
1066507468 10:36060332-36060354 CAGGAGGAAGAGACAGAGTGGGG + Intergenic
1069428672 10:68313283-68313305 CAGAATGAAGAGACAAAGTATGG - Intronic
1069605570 10:69736874-69736896 CAGGGGGAAGACTCAGAGTAGGG - Intergenic
1069687020 10:70324853-70324875 AAGGAAGAACAGTGAAAGTAGGG - Intronic
1069749402 10:70735868-70735890 CAGGCTGAGCTGTCAGAGAATGG + Intronic
1070813147 10:79308336-79308358 CAGGAAGAACAGTTGGAGTTTGG + Intronic
1071494530 10:86158707-86158729 CAGGGTGCACAGTCTGAGTGGGG - Intronic
1071815877 10:89232430-89232452 CAGGATGGAGAGTCAGAGAGAGG + Intronic
1072168519 10:92837771-92837793 CGGAATGAACAGTGAGAGAAAGG + Intronic
1074540985 10:114364991-114365013 CAGGATGAAGAGCCAGAGTCCGG + Intronic
1077508386 11:2942727-2942749 CAGGGTGAACAGTCACAGGAAGG + Intergenic
1079821032 11:25128653-25128675 AGGGATGAACAGGCAGAGTGCGG - Intergenic
1084533521 11:69743347-69743369 AAGGATGAACAGGCAGGGCAGGG - Intergenic
1085777276 11:79378295-79378317 CAGGATAAAGAGCCAGAGAAGGG - Intronic
1086045743 11:82529236-82529258 CAGGATCAAAAATCAGAATAAGG - Intergenic
1086601894 11:88643231-88643253 CAGGAGCAAAAGACAGAGTAGGG + Intronic
1087878291 11:103385311-103385333 CATGATGAACAGAGAGAGAAAGG - Intronic
1091347921 11:134867594-134867616 CACCATGAACAGTAAGAGTAGGG - Intergenic
1092756708 12:11770324-11770346 CAGGATGGGCATTCAGAGGAAGG + Intronic
1093058399 12:14578104-14578126 CAAGATGAACAATAAGAGGATGG - Intergenic
1094019127 12:25895634-25895656 CAGAATGAACAGAGAGAGAAGGG + Intergenic
1103459000 12:121089101-121089123 CAGGCTGAACAGTGTGAGGAGGG + Intergenic
1106075731 13:26459379-26459401 CAGGATGAGCAATGAGAGTGTGG - Intergenic
1107374394 13:39786283-39786305 CAGCATGAATAGCCAGAGGAAGG + Intronic
1110517255 13:76428844-76428866 CAGAAAGACCAGACAGAGTAAGG + Intergenic
1110539759 13:76694985-76695007 CAGGCTGAACAATCAGGGTGTGG + Intergenic
1110565722 13:76955874-76955896 CAGGATGAACAGTCAGAGTAAGG - Intronic
1111145872 13:84179108-84179130 CAGGAGGAAGACTGAGAGTAGGG + Intergenic
1112105051 13:96231189-96231211 CAGGATCAACAGGCACAGTAAGG - Intronic
1112374294 13:98824518-98824540 AAGGAGGGACAGTCAGAGTTAGG + Intronic
1112433174 13:99370799-99370821 CAGGATTAACAGGTGGAGTATGG + Intronic
1117590761 14:57265804-57265826 CAGGATAGACATTCTGAGTAAGG - Intronic
1119634883 14:76265839-76265861 CAGGAGGAAGAGACAGAGAAGGG + Intergenic
1124579108 15:30936874-30936896 AAAGATCAACACTCAGAGTATGG + Intronic
1125190093 15:36981817-36981839 CAGAATGAAAAGGCAGAGAATGG + Intronic
1127117016 15:55738874-55738896 CAGGAGGAAAAGACAGAGGAAGG + Intronic
1127707977 15:61566081-61566103 CAGGAGGAAGAGACAGAGTGGGG + Intergenic
1132251277 15:100337332-100337354 CAGGCTGACCAGTCAGAGTGAGG + Intronic
1132337195 15:101055590-101055612 CAGGAGGAGCAGACAGAATAAGG + Intronic
1132799937 16:1747035-1747057 CAGGATGAAATGTCCGAGTCAGG + Exonic
1133862961 16:9613672-9613694 AAGGAGGAACAGTCATAATAAGG + Intergenic
1134691905 16:16196591-16196613 CAGGAGGCACAGAGAGAGTAGGG + Intronic
1135052997 16:19207515-19207537 CAGGAGGAAGAGACAGAGAATGG + Intronic
1135856348 16:26014485-26014507 GAGGATGGAGAGTCAGAGGAGGG - Intronic
1137776877 16:51062710-51062732 GAGGTTGAACAGGCAGAGCATGG - Intergenic
1138653530 16:58475771-58475793 CAGGAGGAAGAGTCAAAGAATGG + Intronic
1139307729 16:66001646-66001668 CAGGAGGAAAAGTGAGAGGAGGG + Intergenic
1141785889 16:86200704-86200726 CAGGCAGATCAGTCAGAGGAGGG - Intergenic
1144140617 17:12343662-12343684 CTGGATGAAGAATCAGAGTCAGG - Intergenic
1146057359 17:29588192-29588214 CATGATTAAGAGTGAGAGTATGG - Intronic
1148758001 17:49984622-49984644 CAAGATGAGGAGTCAGAGGAGGG - Intergenic
1149587428 17:57801572-57801594 CAGGAGGAAAAGAGAGAGTAAGG - Intergenic
1151265900 17:72954707-72954729 CCTGATCAACAGTCAGAATATGG + Intronic
1151775323 17:76197261-76197283 CAGGAGAAACAGTTACAGTAAGG + Intronic
1153656214 18:7284817-7284839 CAGCATGAACAGTCACATCATGG + Intergenic
1155203249 18:23535744-23535766 CAGGATGAACACGCAGTGTTCGG - Intronic
1155485446 18:26336832-26336854 AAGGAAGAACAGACAGGGTAAGG - Intronic
1157303439 18:46497906-46497928 CAGGATGCACAGTGGGAGTTAGG + Intronic
1157612113 18:48963610-48963632 GAGCATGAACACTCAGACTAGGG + Intergenic
1157846772 18:51011000-51011022 AAGGATTGACAGTCAAAGTATGG - Intronic
1157949839 18:52023669-52023691 CATTATGTACAGTCAGAGTGTGG - Intergenic
1158498396 18:57977745-57977767 AATGATGAACAGTCAAAGAAGGG - Intergenic
1160210443 18:76873927-76873949 CAGGAGGCACAGTGAGAGTGTGG - Intronic
1160210473 18:76874069-76874091 CAGGAGGCACAGTGAGAGTGTGG - Intronic
1160210490 18:76874141-76874163 CAGGAGGCACAGTGAGAGTGTGG - Intronic
1161475697 19:4483605-4483627 CAGGAAGGACAGGCAGAGTAAGG - Intronic
1162328650 19:10013434-10013456 CAGGATGAATGGTCAGAGTCAGG + Exonic
1165198387 19:34125063-34125085 CCAGATGAACAGTCAGGGTAGGG - Intergenic
1165956822 19:39506445-39506467 CAGAATGAACACTCAGTGTTTGG - Intronic
928550079 2:32361657-32361679 AAGGATGAATAGGCAGAGCAGGG - Intronic
928604051 2:32927739-32927761 AAGGATGAACTTCCAGAGTATGG + Intergenic
929896395 2:45964233-45964255 CAGGATTAAAAGTCTTAGTAGGG - Intronic
930742117 2:54842213-54842235 AGTGATGAACAGGCAGAGTATGG - Intronic
932199240 2:69811187-69811209 CAGGAAGAACAGCAAGAATAAGG + Intronic
935633296 2:105230207-105230229 AGGGATGAACAGGCAGAGCATGG + Intergenic
936592641 2:113818688-113818710 CTGGGTGATGAGTCAGAGTAGGG - Intergenic
939237093 2:139508752-139508774 AGGGATGAATAGGCAGAGTATGG + Intergenic
941139993 2:161768286-161768308 CAGGCTCAGCAGCCAGAGTAGGG - Intronic
941390674 2:164910122-164910144 CAGAATGAAGAGTAAGAGAAGGG + Intronic
941595347 2:167470053-167470075 CAGGATGAGGATTCAGAGGAAGG - Intergenic
941995202 2:171595539-171595561 AAGGAGGAAGAGGCAGAGTATGG + Intergenic
943896221 2:193364384-193364406 CAGGAAGAACACGGAGAGTATGG + Intergenic
946618880 2:221539760-221539782 CAGGATCAACACTCAGATTTAGG + Intronic
1168855142 20:1002640-1002662 AAGGAGGAACAGACAGAGAAAGG - Intergenic
1168938537 20:1689115-1689137 CAGGAGGGACAGGGAGAGTAGGG + Intergenic
1169829973 20:9814126-9814148 CAGGATGGCCAGGCAGAGAATGG + Intronic
1170432472 20:16289206-16289228 CTGTATGAGCAGTCAAAGTACGG + Intronic
1173378628 20:42514861-42514883 CAGGATGAAAAGTCAGAAATAGG - Intronic
1174691939 20:52515236-52515258 CAGGTTGAAAAGTCAGAGCCTGG - Intergenic
1175458976 20:59136629-59136651 CAGGATGAAAGCTCAGAGGAGGG - Intergenic
1175785421 20:61708754-61708776 CATGATGCACACTCAGAGAAGGG - Intronic
1176069186 20:63217195-63217217 CAGGGTGAACAGTGACAGCAGGG + Intergenic
1177806056 21:25875777-25875799 CAGAATGAACAGGAAGAGGAAGG + Intergenic
1178252238 21:31014856-31014878 CAGGTCCAACAGTCACAGTAAGG - Intergenic
1178544012 21:33478887-33478909 TAGGATGAAGAGTCTGAGAAGGG + Intronic
1178594959 21:33945012-33945034 CAGGATCAACAGGCAGAGCACGG + Intergenic
1178886758 21:36490789-36490811 CAAACTGAACAGTCAGAGAAAGG - Intronic
1181713262 22:24705180-24705202 CTGGAGGAAGAGTCACAGTAAGG - Intergenic
1184509010 22:44921199-44921221 CAGGGTGGACATTCAGGGTAAGG + Intronic
1184606458 22:45577273-45577295 CCGGAGGAACAGCCAGAGTGGGG + Intronic
950282277 3:11719102-11719124 CAGGAAGCACAGGAAGAGTACGG + Intronic
950425725 3:12923861-12923883 CAGGAAGAGCACTCAGAGCAGGG - Intronic
951857819 3:27217430-27217452 CAGGAGGAAGAGAGAGAGTAGGG + Intronic
952410587 3:33046595-33046617 CAGGATTAACAGTCAGAGATGGG - Intronic
952948856 3:38501602-38501624 CAGGAAGAAAAATAAGAGTATGG - Intronic
953904549 3:46861920-46861942 CAGGAGGGACAGTCATGGTAGGG - Intronic
956935571 3:74096946-74096968 CAGGATGAAAAGGAAGAGTAAGG + Intergenic
958002174 3:87763723-87763745 CAGGCTAAACAGTAAAAGTAGGG + Intergenic
960015191 3:112879411-112879433 GAGGATGAAAAGTGAGAGGAGGG - Intergenic
962121618 3:132566379-132566401 CAGGAAGAAGAGAAAGAGTAAGG + Intronic
962381598 3:134902614-134902636 CAGAATAAACACTCAGGGTAAGG + Intronic
962398070 3:135034889-135034911 TAGGATGCACAGCCAGAGGAAGG + Intronic
962727047 3:138240079-138240101 AAGGATGTACAGTCAGAGGTGGG - Intronic
963586068 3:147190525-147190547 CAACATGAACAGTCAGTGTAAGG - Intergenic
967380781 3:188855454-188855476 CAGGATAAAGAGACAGAGTCTGG + Intronic
969276443 4:6138986-6139008 GAGGATGAACAGACAGGGTGGGG - Intronic
970088193 4:12371467-12371489 CAAGAGGAACAGAGAGAGTAGGG - Intergenic
970726363 4:19049772-19049794 CAGGATGAAAAGGCAGAATGAGG - Intergenic
971045810 4:22803853-22803875 CAGGATGGACAGTCTGGGTGAGG + Intergenic
975714161 4:77189593-77189615 CAAGAGGAATAGTCAGAGTGAGG - Intronic
975953997 4:79814003-79814025 CAAGATGAACTGCTAGAGTAGGG + Intergenic
976768061 4:88619105-88619127 CAGGATGACCAGCCACAGGAAGG - Intronic
976874183 4:89834617-89834639 CAGGATGAACAGTCAGGTGGAGG - Intronic
977605873 4:98984593-98984615 CAGGATGAAAAGTCAGTGCCTGG - Intergenic
980480548 4:133381471-133381493 CAGAATAAAAAGTCAGAGAAGGG + Intergenic
983518039 4:168677811-168677833 CAGGATTAACTGGCGGAGTAGGG - Intronic
984843551 4:184090887-184090909 CAGGATGAACTCTCTGAGCAGGG - Exonic
986166301 5:5274345-5274367 GAGGATGAACAGGCAGAGCATGG - Intronic
986510694 5:8503528-8503550 CAGGAAGAAGAGTGAGAGCAGGG + Intergenic
987480016 5:18441528-18441550 CAAGATGGACAGTGAGAGAATGG - Intergenic
987874738 5:23666891-23666913 AGGGATGAACTGACAGAGTACGG + Intergenic
990240451 5:53811528-53811550 CAGGCAGAACAGTGAGAGTTAGG - Intergenic
992087789 5:73293767-73293789 CAGGAAGAACAGCCAGCCTACGG - Intergenic
992485318 5:77189191-77189213 AAGGATGACAAGTCAGAGTGGGG - Intergenic
992927033 5:81598745-81598767 CTGGATGAACAGGCAGAGCCTGG - Intronic
993197939 5:84774518-84774540 CAAGAGGAACAGTTAGAGCAGGG + Intergenic
994493769 5:100483720-100483742 AGGGATGAACAGGCAGAGTATGG + Intergenic
997061619 5:130511585-130511607 CAGAGTGAACAGTCAGTGGAAGG + Intergenic
1000169024 5:158683473-158683495 CAGGATGAAAAGGCAGACTCAGG - Intergenic
1003731752 6:8832386-8832408 AGGGATGAACAGACAAAGTAGGG - Intergenic
1005182971 6:23127326-23127348 CAGGCTAAAAAGTCAGAGTGAGG - Intergenic
1008555055 6:52665870-52665892 CAGGAAGAAAACTCAGAGCATGG + Intergenic
1009944538 6:70327940-70327962 AAGCATGAACAGTCAGAGCTAGG + Intergenic
1010538080 6:77055637-77055659 CAGGAGGAACAGTCCAAGTATGG + Intergenic
1012907106 6:105080098-105080120 CAGGATGAACATTCAGTGCCAGG + Exonic
1013362800 6:109410309-109410331 CAGGATGAACAGTGACAACATGG - Intronic
1014936173 6:127387625-127387647 CAGGATGATCAGACAAAGTCTGG - Intergenic
1016180366 6:141139206-141139228 CAGGAGGAAGAGACAGAGTGGGG - Intergenic
1016369435 6:143357027-143357049 CAGGAAGAACTGTCAGGGTTGGG - Intergenic
1023484893 7:40675747-40675769 CAGAATGAGCAGTAAGAGTTCGG + Intronic
1023990640 7:45126347-45126369 CAGGCTGAAGAGACAGTGTATGG + Intergenic
1026104152 7:67407849-67407871 CAGGAGGGACACTCAGAGGAGGG - Intergenic
1027832236 7:83193486-83193508 CAGCATGCACAGTCAGAGAGGGG + Intergenic
1028454009 7:91018718-91018740 CAGGAGGAAGAGACAGAGAAGGG - Intronic
1028484391 7:91342248-91342270 CAGGGTGAAGAGTCAGAACAGGG - Intergenic
1028959768 7:96735574-96735596 CAGGATGAACAGGTAGATGATGG - Intergenic
1030327691 7:108238606-108238628 CAGATTGAACAGTCAGATTAAGG + Intronic
1030710866 7:112747540-112747562 CAGGAGGAAGAGTGAGAGGAGGG - Intergenic
1033095796 7:138429703-138429725 GAGAATGAACACTCAGACTAAGG + Intergenic
1034686270 7:152973969-152973991 CAGGAGGAAGAGTGAGAGTGGGG + Intergenic
1036385848 8:8280679-8280701 CAGTAAGAAAATTCAGAGTAAGG - Intergenic
1037475912 8:19257569-19257591 AGGGATGAACAGGCAGAGCATGG + Intergenic
1037835833 8:22214244-22214266 GAGGAGGAACACTCAGAGGACGG + Intergenic
1037849284 8:22313178-22313200 AAAGATGAACAGACAGAGCAAGG - Intronic
1038495816 8:28001549-28001571 CAGGATGAACAGAAAGATTGAGG + Intergenic
1040004829 8:42611019-42611041 AGGGATGAACAGACAGAGCACGG + Intergenic
1041711228 8:60896333-60896355 GAGGCTGAACAGTGGGAGTATGG - Intergenic
1042358636 8:67856975-67856997 CAAGAAGAAAAGTCAGAGAAAGG - Intergenic
1043263298 8:78228713-78228735 CAGGATGAACATCCAGATTCTGG + Intergenic
1044159847 8:88899465-88899487 CAAGATGAAGAGGCAGAGTAAGG - Intergenic
1047360265 8:124162655-124162677 GACAATGAACAGTGAGAGTAGGG - Intergenic
1047440495 8:124873220-124873242 TAGGATGAACAGGCAGAGAAAGG - Intergenic
1050243173 9:3659268-3659290 CAGCATGCAGAGTCAGAGAAGGG + Intergenic
1051743322 9:20272371-20272393 CAGGATGAACTGCCACATTAAGG - Intergenic
1054981837 9:71215823-71215845 CAGGATGAACAGACAGTTCAGGG + Intronic
1055733173 9:79300058-79300080 GGGAATGAACAGTCAGAGTTAGG - Intergenic
1057508408 9:95656199-95656221 AAGGATGAACAGGCAGAGCATGG - Intergenic
1057759381 9:97860377-97860399 TGGGATGGACAGGCAGAGTAGGG + Intergenic
1060360720 9:122954092-122954114 AAGGATGAAGAATTAGAGTAAGG + Intronic
1060404342 9:123365866-123365888 CAGGATGGACACCCAGAGCAGGG - Intronic
1060872751 9:127055937-127055959 CAGAAAGAGCAGTCAGAGGAGGG + Intronic
1062647831 9:137558459-137558481 GAGGATGAACAGACAGAATGTGG + Intronic
1185760504 X:2687106-2687128 CATAATGGACAGTCAGAGGAGGG + Intergenic
1186412540 X:9356598-9356620 CAGGATGATGAGTTAGAGGAGGG + Intergenic
1187008445 X:15254851-15254873 GAGGGGAAACAGTCAGAGTAAGG + Intronic
1188571737 X:31594626-31594648 CAGGATGAAAATTCTGAGTTTGG - Intronic
1189167708 X:38877650-38877672 GAGGATGAGCATGCAGAGTAGGG - Intergenic
1190437676 X:50442544-50442566 CAGGATGATGAGACAGATTATGG + Intronic
1191600708 X:63002068-63002090 CAGGATGACCACTTAGAGTGGGG - Intergenic
1191897670 X:66010779-66010801 CAGGATCAATAATCAGAGAAAGG - Intergenic
1194460578 X:94162320-94162342 CAGGAGGAAGAGTTAGAGAAGGG - Intergenic
1195101591 X:101560420-101560442 CAGGATGAGCAGTTTGGGTATGG + Intergenic
1195989894 X:110672064-110672086 CAGGAGGAACAGACAGAGGAGGG + Intergenic
1196942868 X:120794833-120794855 CAGGGTGAACAATAAGAATAAGG - Intergenic
1197100831 X:122652623-122652645 CAGATTGAACATTCAGAGTCCGG + Intergenic
1198279273 X:135126010-135126032 GAAGATGAATAGACAGAGTAAGG - Intergenic
1198291684 X:135246510-135246532 GAAGATGAATAGACAGAGTAAGG + Intergenic
1198560813 X:137848190-137848212 CTTGCTGAACAATCAGAGTATGG + Intergenic
1201385674 Y:13437190-13437212 CAGGATGAAGAGGCAGGGCAGGG + Intronic
1201488895 Y:14520624-14520646 AAGGAAGAACATTCAGAGTAGGG - Intergenic
1202593920 Y:26516360-26516382 TAGCATGATCAGTGAGAGTAAGG + Intergenic