ID: 1110576837

View in Genome Browser
Species Human (GRCh38)
Location 13:77067231-77067253
Sequence GGGGGAATAAAGTAAAGTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 187}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110576837_1110576842 0 Left 1110576837 13:77067231-77067253 CCTGAACTTTACTTTATTCCCCC 0: 1
1: 0
2: 2
3: 21
4: 187
Right 1110576842 13:77067254-77067276 ATATTTATTTCTTTTTATTGTGG 0: 1
1: 2
2: 42
3: 415
4: 4002

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110576837 Original CRISPR GGGGGAATAAAGTAAAGTTC AGG (reversed) Intronic
900740110 1:4325906-4325928 GGGGGAAGAAAGTAAATTTCTGG + Intergenic
902175820 1:14649894-14649916 GAGGGAAGAAAGTAAAGGTTAGG + Intronic
906572679 1:46857655-46857677 GGGTGAAGAAAGTGAAGTTGTGG + Intergenic
906599096 1:47108236-47108258 GGGTGAAGAAAGTGAAGTTGTGG - Intronic
907358391 1:53894955-53894977 GGTGTAATAAAGAAAAGTTTAGG - Intronic
907536835 1:55169743-55169765 TGGGAAATAAAGTAAAGTTCAGG + Intronic
911018300 1:93358663-93358685 GAGGGAATAAAGGAAAATGCTGG - Intronic
916556096 1:165895658-165895680 GGGAAAATAAAGAAAAGTTTTGG - Intronic
919126607 1:193401982-193402004 GGTAAAATAAAGTGAAGTTCAGG - Intergenic
920028107 1:203016253-203016275 AGGGGACTAATGTAAACTTCAGG + Intronic
921037353 1:211394067-211394089 GGGGGAAGAAAGTAAATGTAGGG - Intergenic
922031803 1:221808351-221808373 GAGGGAAGATAGAAAAGTTCTGG + Intergenic
923930758 1:238693117-238693139 GGGGGAATAAACTAAACTCCAGG + Intergenic
1063646382 10:7887728-7887750 GGGGGGATAAAGGAAAGTTAAGG + Intronic
1068588132 10:58823711-58823733 GGGGGAATAACATACAATTCAGG - Intronic
1070428972 10:76317042-76317064 GGGAGAATAGAGTAATGGTCAGG + Intronic
1072436772 10:95421342-95421364 GAGGGAAGAAAGAAAAGATCAGG + Intronic
1073649776 10:105345768-105345790 AGGGGAATCAATTAAAGGTCAGG + Intergenic
1078291722 11:10017381-10017403 CGGGGAAAACAGTATAGTTCTGG + Intronic
1083498889 11:63084664-63084686 GGGGAAAGAAAGCAAAGGTCGGG - Intronic
1086098042 11:83070142-83070164 GGGGGAAGAAATGAAAGTACAGG + Intronic
1086344328 11:85880939-85880961 GGGAAAATAAAGTTAACTTCAGG - Intronic
1087230534 11:95656441-95656463 GGAGGATTAAAATAAAGTTGGGG - Intergenic
1088631849 11:111781085-111781107 GGGAAAATAAATTAAAGTTGTGG + Intergenic
1092403763 12:8200449-8200471 GGGGGAATAACGTCACTTTCGGG - Intergenic
1094196407 12:27754257-27754279 GGGGGAAAAAAGAAAATTCCAGG + Intronic
1096417968 12:51430027-51430049 TGGGGACTGAAGGAAAGTTCAGG + Intronic
1098515450 12:71371164-71371186 TGGTGAAGAAAGTAATGTTCTGG + Intronic
1099928647 12:89048174-89048196 GAGGAAATAAAGTTGAGTTCAGG + Intergenic
1101606255 12:106248823-106248845 GGGGGGAAAAAGTAAAGAGCTGG - Intronic
1102643387 12:114386289-114386311 GATGGATTAAATTAAAGTTCTGG - Intronic
1108411146 13:50148334-50148356 GGGGGAAAAAAGCAAACTTTGGG + Intronic
1109660989 13:65459920-65459942 AGGGGAATAAGGAAAAGTTTGGG + Intergenic
1110576837 13:77067231-77067253 GGGGGAATAAAGTAAAGTTCAGG - Intronic
1110752986 13:79137274-79137296 GGGTGAATAAAGTAATACTCTGG - Intergenic
1111972213 13:94928567-94928589 GGAGGAAAAGAGTGAAGTTCTGG - Intergenic
1112135229 13:96570693-96570715 AGGGGTAAAAAGTAAAGTACGGG + Intronic
1112991085 13:105514680-105514702 GGGGGAATAAAATTATTTTCAGG + Intergenic
1114876921 14:26731731-26731753 GGCAGAATAAACTAAAGATCAGG + Intergenic
1115033448 14:28828311-28828333 GGAGGAAGAAAGTAAAGTACAGG - Intergenic
1116759664 14:48995839-48995861 GAAGGAAGAAAGTCAAGTTCAGG - Intergenic
1120161211 14:81146912-81146934 GTGGCAATAAAGTAAAAGTCAGG + Intergenic
1120270460 14:82307497-82307519 GGGGAATTCAATTAAAGTTCTGG + Intergenic
1121764566 14:96474964-96474986 GGGGGATTAAATTAAAACTCAGG + Intronic
1121877324 14:97465126-97465148 GGGGGAATAAAGGAAACCTACGG + Intergenic
1123498026 15:20849901-20849923 GGAGGAATAGTGTACAGTTCAGG - Intronic
1123555257 15:21423529-21423551 GGAGGAATAGTGTACAGTTCAGG - Intronic
1123591502 15:21860860-21860882 GGAGGAATAGTGTACAGTTCAGG - Intergenic
1124642802 15:31407087-31407109 GGGGAAATAAAGAAATGTTGGGG + Intronic
1126056705 15:44736563-44736585 GATGGAAGAAAGAAAAGTTCAGG - Exonic
1126826740 15:52558838-52558860 GGGGGAAAAAATTACAGGTCAGG + Intronic
1127287879 15:57546588-57546610 GGAGAAATAAGGTGAAGTTCTGG + Intronic
1127927444 15:63560657-63560679 GGGGGAATAAAGTCAATTTTTGG + Intronic
1130031842 15:80322044-80322066 GCGGGAATAAAGCACAGTTATGG - Intergenic
1130221055 15:82020080-82020102 GGGGGAAAAAAGGAATGGTCTGG + Intergenic
1131354154 15:91729887-91729909 GGGGTGATAAAATAAAGTGCTGG + Intergenic
1202963603 15_KI270727v1_random:150738-150760 GGAGGAATAGTGTACAGTTCAGG - Intergenic
1133400958 16:5486610-5486632 GGGGGAAGAAAGAGATGTTCTGG - Intergenic
1135377570 16:21962018-21962040 GGGAGAAGATAGAAAAGTTCCGG - Intronic
1135956579 16:26961069-26961091 GGGGAAATAAAATAAACTCCCGG + Intergenic
1138830304 16:60367064-60367086 GGAGGAACAGTGTAAAGTTCAGG + Intergenic
1140190597 16:72812579-72812601 GGGGGAAAAAAATCAAGTTTGGG + Intronic
1140855890 16:78977474-78977496 GGGAAAATAAAGTAAAGGACAGG - Intronic
1147567198 17:41545023-41545045 GGGGGAATAAATGAAAAATCAGG + Intergenic
1150675591 17:67244591-67244613 GGGGGAAGAAAGTGAATCTCGGG + Intronic
1151007085 17:70450265-70450287 AGGAGAAGAAATTAAAGTTCAGG + Intergenic
1151810544 17:76438226-76438248 TGGGGAATGATGAAAAGTTCTGG + Intronic
1153053548 18:923612-923634 GGAGGAAAAATGGAAAGTTCAGG + Intergenic
1154456027 18:14526330-14526352 GGAAGAATAATGTACAGTTCAGG - Intronic
1155727457 18:29105938-29105960 GGGGGAACACAGGAAAATTCTGG - Intergenic
1156040600 18:32816380-32816402 GGGGAAACAAATTAAAATTCAGG + Intergenic
1160814785 19:1029997-1030019 GGGAGAATAAAGTAGGGTTTGGG - Intronic
1167333915 19:48873192-48873214 GGGAGAAAAAAATAAAGTTTAGG - Intronic
925723762 2:6853350-6853372 GGCAGAATAATGTACAGTTCAGG - Intronic
929393538 2:41497351-41497373 GGGGGAATACAGACTAGTTCAGG + Intergenic
931971988 2:67598431-67598453 AGTAGAATTAAGTAAAGTTCTGG - Intergenic
932517276 2:72365189-72365211 TGGGGAAAAAAGAAAAGTACAGG - Intronic
934086766 2:88516341-88516363 AGGAGAATAAAGTAAAACTCTGG - Intergenic
935107906 2:100062572-100062594 GGGGAACTAAACTAAAATTCCGG + Intronic
936624151 2:114130289-114130311 TTGAGAATAAAGCAAAGTTCAGG - Intergenic
937789944 2:125948814-125948836 GGGGGGATAAAAAAAAGCTCAGG + Intergenic
938283715 2:130089007-130089029 GGAGGAATAATGTACAGTTTAGG - Intronic
938284857 2:130103532-130103554 GGAGGAATAATGTACAGTTCAGG - Intronic
938308554 2:130270038-130270060 GGGAGAATACAGTAGAGTTGGGG + Intergenic
938334359 2:130477571-130477593 GGAGGAATAATGTACAGTTTAGG - Intronic
938335501 2:130492084-130492106 GGAGGAATAATGTAGAGTTCAGG - Intronic
938354323 2:130628584-130628606 GGAGGAATAATGTAGAGTTCAGG + Intronic
938355467 2:130643097-130643119 GGAGGAATAATGTACAGTTTAGG + Intronic
938430747 2:131235358-131235380 GGAGGAATAATGTAGAGTTCAGG + Intronic
938431892 2:131249886-131249908 GGAGGAATAATGTACAGTTTAGG + Intronic
938475565 2:131608511-131608533 GGAGGAATAATGTACAGTTTAGG + Intergenic
938510241 2:131935151-131935173 GGGGGAAAAAAGTAAGTTTATGG + Intergenic
940047074 2:149421107-149421129 GTGGGATTAAAGAAAAGTGCTGG - Intronic
941757619 2:169204722-169204744 AGGAGAATAAAGAAAAGATCAGG + Intronic
943008404 2:182415611-182415633 GGAGGGAAAAAATAAAGTTCAGG - Intronic
943691864 2:190877654-190877676 TGGAGAATAGAGTAAGGTTCAGG - Intergenic
943869093 2:192969907-192969929 GGGAGAATAAAATAAAATTTTGG - Intergenic
944331864 2:198478157-198478179 TAGGGAATAAAGTAGAGTTGGGG + Intronic
945318079 2:208392241-208392263 TGGGGAATGAAGAATAGTTCAGG - Intronic
945690438 2:213027600-213027622 AGGGGGACAAAGGAAAGTTCTGG - Intronic
948035624 2:234856028-234856050 GGGGGAATAAAGGAAAACTGAGG + Intergenic
1169089114 20:2847172-2847194 GGGGTACAAAAGTAAAGGTCAGG - Intronic
1169579304 20:7001205-7001227 GGTGAAATAAAGTATGGTTCAGG + Intergenic
1172428430 20:34871963-34871985 AGGGGAACACAGTAAAATTCTGG + Intronic
1173437686 20:43047502-43047524 GGGGCAGGAAAATAAAGTTCAGG + Intronic
1175605048 20:60305849-60305871 GGGGGAATTCAGTAAAAATCAGG - Intergenic
1176783581 21:13228174-13228196 GGGGGAAAAAAGTAAGTTTATGG - Intergenic
1176818136 21:13627010-13627032 GGAGGAATAATGTACAGTTCAGG + Intronic
1177427640 21:20945029-20945051 AGGGCAATAAAGTAAAGCTCAGG + Intergenic
1177558783 21:22723933-22723955 GGGAGAATGAAGAAAATTTCTGG - Intergenic
1177981229 21:27916943-27916965 GGGGGAAAAAAGTAAGTTTATGG - Intergenic
1181739593 22:24910239-24910261 GGGGGGGTAAAGAAATGTTCTGG + Intronic
1181794951 22:25300903-25300925 CTGGGAATAAAGGAAATTTCAGG + Intergenic
1182137711 22:27920823-27920845 GGGGGAATAAAATGAGATTCAGG + Intergenic
952036771 3:29212408-29212430 TGGGCAATCAAGTTAAGTTCAGG - Intergenic
952833762 3:37587328-37587350 GGGAGAAAACAGTTAAGTTCAGG + Intronic
953479254 3:43235684-43235706 TGGGGAAGATAGAAAAGTTCTGG - Intergenic
953520515 3:43638098-43638120 GGAGGAATAATGTAGAGTTTAGG - Intronic
954022472 3:47754499-47754521 GGTGTAAAAGAGTAAAGTTCAGG - Intronic
955288999 3:57673443-57673465 GGGGGAATAAAGAACGGTTAAGG + Intronic
957448827 3:80349484-80349506 GGGGGAAAAAAGATGAGTTCAGG + Intergenic
957922603 3:86765248-86765270 GGTTGAATACAGTTAAGTTCTGG + Intergenic
959740012 3:109707703-109707725 GGCTTAATAAAGTAAAGTTTGGG + Intergenic
960514395 3:118587868-118587890 GGAGGAAAAAAATAAAGTTCTGG + Intergenic
961599202 3:128046078-128046100 GAGGGAATATGGTAAATTTCTGG - Intergenic
961918489 3:130401736-130401758 GGGGAAAAAAAGTAAAGCTGAGG - Intronic
962036756 3:131660079-131660101 TGGGGAAAACAGAAAAGTTCTGG - Intronic
962432627 3:135334200-135334222 GGGGAAATAAAGTAAATTGGAGG - Intergenic
962904593 3:139790227-139790249 GGGGGAATAAAGGCAAGGCCTGG + Intergenic
963478735 3:145840493-145840515 GAGGGAATTTAGTAAACTTCAGG - Intergenic
966071112 3:175879291-175879313 GGGAGAATAAAGACAATTTCAGG + Intergenic
967049013 3:185764982-185765004 GGGGGAAGAAAGTAAAACACTGG - Intronic
970623594 4:17852294-17852316 GGGGGAAAAATGTAAAGACCTGG + Intronic
970795154 4:19903660-19903682 GTGGGAATATAGTTAACTTCTGG - Intergenic
973252984 4:48079996-48080018 GGGAGAATAAAGGAAAGCTTAGG - Exonic
974067871 4:57097054-57097076 GGGGGAAAAAATTGAAGTACTGG - Intronic
976123036 4:81803876-81803898 GGGTGAATTAAGTAAAATTTTGG - Intronic
977247527 4:94650792-94650814 GGGGGAAGAAAGGAAAGGTAGGG - Intronic
977447385 4:97148376-97148398 TGGGGAATAAAGCAAAGTAAAGG - Intergenic
982533422 4:156577334-156577356 GGGAGAGTAAAGTAAAGGACTGG + Intergenic
983095614 4:163558027-163558049 GGGGGAAAAAAGAAAAATTTGGG + Intronic
984265035 4:177488132-177488154 GTGGAAAGAAAGTAGAGTTCAGG + Intergenic
984581079 4:181510941-181510963 GGGGGAATAAAGTTAACTTAAGG - Intergenic
985007692 4:185550400-185550422 GGGGAAATAAAGGAAAATTGGGG + Intergenic
986071515 5:4289102-4289124 TGGGGAATAAAGAAAAGTTTGGG + Intergenic
987119762 5:14756025-14756047 GGGGGTATAAAGTGTATTTCAGG - Intronic
987774916 5:22352613-22352635 TGGGAAATAAAATCAAGTTCTGG + Intronic
990690620 5:58359671-58359693 GCAGCAATAAAGTAATGTTCTGG + Intergenic
991017507 5:61947566-61947588 GGTGGAAGAAAGAAAACTTCAGG + Intergenic
992259807 5:74958357-74958379 AGGGGAATGAAGAAAAGTTCTGG + Intergenic
992819282 5:80479776-80479798 GGGGACAGAAATTAAAGTTCAGG + Intergenic
993321137 5:86468408-86468430 TTGGGAATACAGAAAAGTTCTGG + Intergenic
993595173 5:89845350-89845372 GGTGGAATAATGGAAATTTCTGG + Intergenic
993686179 5:90940987-90941009 GGGGGAAAAAAGCAAATCTCAGG - Intronic
996776905 5:127142741-127142763 GGGGGCCTTAAGTAAAGATCCGG - Intergenic
999136360 5:149322571-149322593 GGAGGAAGACAGTCAAGTTCAGG - Intronic
999356052 5:150932465-150932487 TGGGTAAGAAAGTAAAGTTATGG + Intergenic
1000346068 5:160314410-160314432 GGGGGAAAAAAGTAAAACTAAGG + Intronic
1000821027 5:165983477-165983499 GGTAAAATAAAGAAAAGTTCAGG - Intergenic
1001216522 5:169860982-169861004 GGGGAAATAAAGAAAAGTACTGG + Intronic
1007122491 6:39394882-39394904 GGGGAAATCAAGACAAGTTCCGG - Intronic
1008869759 6:56259241-56259263 GGGGGAATGCAGTAAACTCCAGG - Intronic
1010418782 6:75647206-75647228 GGGGGAAAAAAGCAAAATTTGGG - Intronic
1011344215 6:86351305-86351327 GGGGCTATAAAGAGAAGTTCAGG - Intergenic
1012360110 6:98366778-98366800 GTGGGGAAAAAGGAAAGTTCAGG + Intergenic
1012431413 6:99167471-99167493 GGGGGAATGAAGTGATATTCGGG + Intergenic
1013923222 6:115435371-115435393 AGTGCAATAAAGTAAAGTTGGGG + Intergenic
1014621382 6:123671365-123671387 GGGGGATTAAAGTACAACTCTGG + Intergenic
1015327156 6:131936086-131936108 TTGGGAATAAGATAAAGTTCTGG - Intergenic
1016162553 6:140898944-140898966 GTGGAAATAAAGTAAAGCTTGGG - Intergenic
1021285519 7:18776818-18776840 TGGGGAAGCAAGGAAAGTTCAGG + Intronic
1021430950 7:20558818-20558840 GGGGGAAAAATATCAAGTTCAGG + Intergenic
1021594776 7:22303271-22303293 GGGGGAAAAAAGAACAGTTATGG - Intronic
1022871709 7:34487014-34487036 GGGGGAAAAAAATCCAGTTCTGG + Intergenic
1023423457 7:40009276-40009298 GGAGGAATAAAATATAGTTCAGG - Intronic
1024453361 7:49575306-49575328 GGGAGAATAAAGGAAAGTAAAGG + Intergenic
1027567337 7:79812451-79812473 GGGGGAAAAAAGTATAGTATAGG - Intergenic
1027793532 7:82662179-82662201 AGGAGTAGAAAGTAAAGTTCTGG - Intergenic
1028070912 7:86449371-86449393 AGGAGAATATAATAAAGTTCAGG + Intergenic
1028681037 7:93532431-93532453 GGCAGAGTAGAGTAAAGTTCAGG + Intronic
1032945584 7:136848468-136848490 GGGGGGTTAAATTTAAGTTCTGG + Intergenic
1033425046 7:141236394-141236416 GGGAGAAAGAAGTAATGTTCAGG - Intronic
1038111144 8:24499355-24499377 TGGGGAATAAAGTAAATATATGG - Intronic
1041747979 8:61230131-61230153 GGAGGAATAAACTAAGGTTGAGG + Intronic
1042377177 8:68065031-68065053 GGGTGTATAAACTACAGTTCGGG - Intronic
1043109764 8:76166227-76166249 ATGGGAATAAAATAAAGTACAGG - Intergenic
1046614722 8:116463569-116463591 GGGGGCATGAAGTTAAGTTCAGG - Intergenic
1047488825 8:125357422-125357444 GAGGGAGTAAAGAAAAGTGCTGG + Intronic
1050318735 9:4429320-4429342 GGGGGAATAAGGGAGAGTTGGGG - Intergenic
1050329259 9:4528999-4529021 TGAGGAAGAAAGTGAAGTTCTGG - Intronic
1051443746 9:17117357-17117379 TGGGGAATAAAGTATGGCTCTGG + Intergenic
1052039061 9:23717407-23717429 GGGGGATAAATGTAAAGTACAGG + Intronic
1052389741 9:27865633-27865655 GGGGGAATGAAGTAAATTAAAGG + Intergenic
1053507532 9:38655951-38655973 GGGGGAACAAGGAAAAGGTCAGG - Intergenic
1055022239 9:71682779-71682801 GGGGGAAGGGAGTAAAGTCCAGG + Intergenic
1055741047 9:79389878-79389900 GGGGGCATGAAGTAAAAATCCGG + Intergenic
1056335573 9:85565371-85565393 GGTTGAATAAAGCAAAATTCTGG + Intronic
1056436035 9:86576919-86576941 GAGGGAATAAAATGTAGTTCAGG + Intergenic
1060187930 9:121575193-121575215 GGGGGTGTTAAGTACAGTTCAGG - Intronic
1203529223 Un_GL000213v1:122494-122516 GGAGGAATAATGTACAGTTCAGG - Intergenic
1186797463 X:13060975-13060997 GGAGAAATAAAGTCAAGTTCTGG + Intergenic
1187939726 X:24369888-24369910 TGGGGATTAAAGTAAAGGTGAGG + Intergenic
1188576027 X:31651279-31651301 GGTGGCAGAAAGTACAGTTCTGG + Intronic
1190581392 X:51895018-51895040 GGGGGAAAAAATTAAATCTCTGG - Intronic
1193136711 X:77979931-77979953 GGGTGATTAAATTAAACTTCAGG - Intronic
1193264591 X:79453440-79453462 GGTGGAATAGACTAAACTTCTGG + Intergenic
1193422615 X:81301203-81301225 GTAGGAATAAAGTAAGGTTATGG - Intergenic
1195905340 X:109838903-109838925 GGGGAAATAAAGTAAATTCCAGG - Intergenic
1195934135 X:110109052-110109074 GGGGGAGAAAGATAAAGTTCAGG - Intronic
1196844653 X:119888538-119888560 GGGGGTAAGAAGTAAAGTTCTGG + Intergenic
1198319730 X:135508176-135508198 GGTGTAATAAATTAAAATTCTGG - Intergenic