ID: 1110578242

View in Genome Browser
Species Human (GRCh38)
Location 13:77085777-77085799
Sequence GCACACTATGTAACCAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 195}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110578235_1110578242 27 Left 1110578235 13:77085727-77085749 CCTAGGCCAGCATTCTGGAGGAT 0: 1
1: 0
2: 2
3: 42
4: 287
Right 1110578242 13:77085777-77085799 GCACACTATGTAACCAAAACAGG 0: 1
1: 0
2: 0
3: 7
4: 195
1110578236_1110578242 21 Left 1110578236 13:77085733-77085755 CCAGCATTCTGGAGGATAAAAGA 0: 1
1: 0
2: 2
3: 18
4: 230
Right 1110578242 13:77085777-77085799 GCACACTATGTAACCAAAACAGG 0: 1
1: 0
2: 0
3: 7
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110578242 Original CRISPR GCACACTATGTAACCAAAAC AGG Intronic
901586200 1:10295178-10295200 ACACACGAAGTGACCAAAACAGG - Intronic
904264393 1:29310121-29310143 GCACAGTACGTGACCATAACAGG + Intronic
904399450 1:30246577-30246599 GAACACTATTTAACAAACACCGG + Intergenic
908623084 1:66007606-66007628 GCTCAGTATGTCACCATAACAGG - Intronic
909101627 1:71356405-71356427 GCAAACTATGTATCCAACAAAGG - Intergenic
909806676 1:79881379-79881401 GCAAACTATGCATCCAAAAAAGG + Intergenic
911040141 1:93584740-93584762 GCACACTGTGTAACCACACAAGG + Intronic
911132696 1:94406443-94406465 GCACACTTTGTGAGAAAAACTGG - Intergenic
915655842 1:157359852-157359874 GCAAACTTTGTAACAAACACAGG - Intergenic
918653246 1:186991993-186992015 GCAGACTAAGTAATCAAAACTGG + Intergenic
918930290 1:190846808-190846830 GCAAACTATGTATTCAAAAAAGG + Intergenic
920188958 1:204180113-204180135 GCTCTCTATGTCACCAAAGCTGG - Intergenic
920796530 1:209142565-209142587 GCAAACTATGTATCTAAAAAGGG - Intergenic
1064142269 10:12800276-12800298 GCCAACTTAGTAACCAAAACAGG - Intronic
1071799703 10:89044879-89044901 GCAAACTATGTATCCAACAAAGG - Intergenic
1072182816 10:93004362-93004384 GAACTCTCTGTAACCAACACTGG + Intronic
1072839733 10:98758421-98758443 GCAATCTATGTATCCAAAAAAGG + Intronic
1074003863 10:109399268-109399290 GAATACTATGCAACCAAAAAAGG + Intergenic
1074745169 10:116524859-116524881 GCTCACTCTGTACCCAGAACAGG + Intergenic
1076537661 10:131192117-131192139 GCAAACTATGTATCCAACAAAGG + Intronic
1077523528 11:3050366-3050388 GCACACTCCCTAGCCAAAACTGG + Intronic
1078825726 11:14928589-14928611 GCAAACTATGTATCCAACAAAGG - Intronic
1079846850 11:25483048-25483070 GCAAACTATGTATCCAACAAAGG + Intergenic
1080079297 11:28195611-28195633 GCAAACTATGCAACCAACAAAGG - Intronic
1081504084 11:43696817-43696839 GAATACTATGCAACCAAAAAAGG + Intronic
1081952427 11:47055925-47055947 GGTCTCTATGTAAACAAAACTGG + Intronic
1082907554 11:58326971-58326993 GCAAACTATGTATCCAATAAAGG - Intergenic
1085222526 11:74887309-74887331 TCAAACTATGTAACCAACAAAGG + Intronic
1088960723 11:114662186-114662208 CCACACTATGTCACCAATGCTGG - Intergenic
1089740990 11:120583251-120583273 GCAAACTATGTATCCAACAAAGG - Intronic
1090294448 11:125574273-125574295 GCACACTGTAGAACCAACACAGG - Intronic
1091004603 11:131941597-131941619 GAACACTGTGGAACAAAAACAGG + Intronic
1091255417 11:134180361-134180383 GATCATTATTTAACCAAAACGGG - Intronic
1092315124 12:7403749-7403771 GGACAATATGTGACCAGAACTGG - Exonic
1093183329 12:15991357-15991379 GCAAACTATGCATCCAAAAAAGG - Intronic
1094597794 12:31881073-31881095 GCACACTATAAACCCTAAACTGG - Intergenic
1095842715 12:46711707-46711729 GCAAACTATGCAACCAATAGGGG + Intergenic
1096062462 12:48713368-48713390 GCACATTATGTAATAATAACTGG - Intronic
1099287759 12:80736210-80736232 TTACAATATGTAACCAAAAAAGG + Intergenic
1099463989 12:82959911-82959933 GCACACTATGCATCCAACAGAGG + Intronic
1099633646 12:85183013-85183035 TAAAACTATGTAACCAAAGCTGG - Intronic
1103422056 12:120794312-120794334 GCACACTATAAAGCCAAAAAAGG - Intronic
1105343361 13:19549247-19549269 GCAAACTATGCAACCAACAAAGG + Intergenic
1107274985 13:38667768-38667790 GCACCCTATGAAACCACAGCTGG - Intergenic
1107476648 13:40743440-40743462 GCAAACTATGTATCCAATAAAGG + Intronic
1107510492 13:41079048-41079070 GCAAACTATGCATCCAACACAGG + Intronic
1107701494 13:43052796-43052818 GCAAACTATGTATCCAACACAGG - Intronic
1108007964 13:45971740-45971762 GCAAACTATGTATCCAACAAAGG + Intronic
1108111443 13:47077884-47077906 GCAAACTATGTATCCAACAAGGG + Intergenic
1108426265 13:50304753-50304775 GCAAACTATGTATCCAAAAAAGG - Intronic
1110578242 13:77085777-77085799 GCACACTATGTAACCAAAACAGG + Intronic
1111047510 13:82833967-82833989 GCAAACTATGTATCAAAAAGAGG + Intergenic
1111283224 13:86053947-86053969 GGACATTATGTAACCATAAAAGG + Intergenic
1111610915 13:90605275-90605297 GCAAGCTATGTAACCAAGTCTGG + Intergenic
1112233948 13:97618172-97618194 GCAAACTATGTATCCAACAAAGG + Intergenic
1112278565 13:98043318-98043340 GCTCACTATGTTACCCAGACTGG + Intergenic
1112863966 13:103870994-103871016 GCAAACTATGCATCCAAAAAAGG - Intergenic
1112994111 13:105551518-105551540 TCTCACTCTGTAACCAAGACTGG - Intergenic
1114579887 14:23747745-23747767 TCACACTATGTAACCCAGGCTGG - Intergenic
1119813479 14:77544203-77544225 TCACACTATGTCACCCAGACTGG + Intronic
1125752688 15:42040138-42040160 TCTCACTATGTTACCCAAACTGG - Intronic
1126914055 15:53445467-53445489 GCACACTCAGTATCCAACACAGG + Intergenic
1127034780 15:54903765-54903787 GCAAACTATGCATCCAAAAGGGG + Intergenic
1127320709 15:57842651-57842673 GCAAACTATGCATCCAACACAGG - Intergenic
1128401397 15:67285344-67285366 GCAAACTATGTAACCGACAAAGG - Intronic
1129152986 15:73700827-73700849 GCACACAATCTAACCATTACCGG + Intronic
1131666673 15:94578272-94578294 GTATACTATGTAAGCAAAACTGG - Intergenic
1135803402 16:25520160-25520182 TCCCACTATGTAGCCAAAGCTGG + Intergenic
1138991267 16:62393051-62393073 GCAGACTATTTAAGCAAAGCTGG - Intergenic
1143535054 17:7533365-7533387 TCTCACTATGTTACCAAAGCTGG - Intergenic
1143925107 17:10362690-10362712 TCAAACTATGTAACCAATTCTGG + Intronic
1144077127 17:11729443-11729465 GCACACCATATAATCAAAAATGG + Intronic
1145201183 17:20946346-20946368 GCAAACTATGCATCCAATACAGG - Intergenic
1147734804 17:42629204-42629226 TCTCACTATGTTACCCAAACTGG + Intergenic
1150948338 17:69773038-69773060 GCAAACTATGCATCCAAAAAAGG + Intergenic
1165401925 19:35606566-35606588 TCACACTATGTCACCCAGACTGG + Intergenic
925577824 2:5378959-5378981 GCAAACTATGTACCCCACACAGG + Intergenic
926775795 2:16421723-16421745 TCACACTTTGTCACCAAATCGGG - Intergenic
929328155 2:40644140-40644162 TCTCACTATGTTACCCAAACTGG + Intergenic
931732522 2:65165743-65165765 ACTCACTATGCAGCCAAAACAGG - Intergenic
931917883 2:66979032-66979054 GAATACTATGTAACCAAAAAAGG + Intergenic
937461602 2:122093258-122093280 GCAAACTATGTATCCAACAAAGG - Intergenic
938990201 2:136620152-136620174 GCACACTATGCATCCAACAAAGG - Intergenic
939364830 2:141218439-141218461 GAACACTATGTAGCCATAAAAGG + Intronic
939624810 2:144463631-144463653 TCTCACTATGTCACCCAAACTGG - Intronic
940282000 2:151998420-151998442 GCAGAGTAAGGAACCAAAACTGG - Intronic
940438574 2:153685566-153685588 GCAAACTATGCATCCAACACAGG - Intergenic
941275231 2:163482708-163482730 CTACACAATCTAACCAAAACGGG + Intergenic
941504733 2:166328183-166328205 ACAAACCATGTAACCAATACTGG - Intronic
943057404 2:182999235-182999257 GCAAACTATGTACCCAACATAGG + Intronic
944376107 2:199043978-199044000 GCAAACAATGTAACAAAAATGGG - Intergenic
945078249 2:206062191-206062213 GAACACTTTTTAACCAAAAAAGG + Intronic
946878383 2:224153108-224153130 GCAAACTATGTATCCAACAAAGG - Intergenic
948773487 2:240266181-240266203 GCAAACTATGTATCCAACAAAGG - Intergenic
1170865085 20:20147643-20147665 GCAAACTATGTACCCAACAAAGG - Intronic
1173281212 20:41629752-41629774 GCAAACTATGCATCTAAAACAGG - Intergenic
1174604136 20:51748247-51748269 TCTCACTATGTAACCCAAGCCGG - Intronic
1177276731 21:18922008-18922030 GCAAACTATGTAACCCACATCGG + Intergenic
1177372056 21:20217490-20217512 GCAAACTATGCATCCAAAAAAGG + Intergenic
1179175407 21:39004711-39004733 CCTCACTATGTGACCCAAACAGG - Intergenic
1180563477 22:16642036-16642058 GCAAACTATGTATCCAACAAAGG - Intergenic
1181872793 22:25913762-25913784 GCAAAATACGTAACCAAAAATGG - Intronic
1182920996 22:34078786-34078808 GCAAACTATGTAACCAGCAGGGG + Intergenic
1183772081 22:39935406-39935428 GGGCACTATTTAATCAAAACTGG + Intronic
950917541 3:16661313-16661335 GCAAACTATGTATCCAACAAAGG + Intronic
951319081 3:21223335-21223357 GCACACTGTGTAAAGAAAATAGG - Intergenic
951758906 3:26123451-26123473 GCAAACTATGTATCCAACAAAGG + Intergenic
952479687 3:33748363-33748385 GCACTCTAGGTAACAAAAACAGG - Intergenic
953244584 3:41178964-41178986 GCAAATTATGTAACCAATCCTGG - Intergenic
957956999 3:87200127-87200149 GGACACTAATGAACCAAAACTGG + Intergenic
959006237 3:101023199-101023221 GCAAACTATGTATCCAACAAAGG - Intergenic
959410913 3:106019820-106019842 CAACAATATGTAAACAAAACCGG - Intergenic
959879658 3:111429079-111429101 GCACCCTCTGTAGCCAAAGCTGG - Intronic
960428684 3:117541984-117542006 GCACACAAAGTAAACAACACAGG + Intergenic
962717791 3:138142298-138142320 GCAAACTATGTATCCAATAAAGG + Intergenic
965064033 3:163821709-163821731 GCAAACTATCTAACCAACAAAGG + Intergenic
970360759 4:15306779-15306801 GCACAGTATATAGCAAAAACAGG + Intergenic
970577486 4:17442129-17442151 GCAAACTATGTACCCAACAAAGG + Intergenic
974210713 4:58770958-58770980 GCAAACTATGTATCCAACAAAGG - Intergenic
975390234 4:73807711-73807733 GCAACCTATGTATCCAAAAAAGG + Intergenic
975561252 4:75710156-75710178 TCTCACTATGTTACCAAAGCTGG + Intronic
976086778 4:81415002-81415024 GCAAACTATGTATCCAACAAAGG + Intergenic
977001533 4:91510725-91510747 GCAAACGATGTATCCAAAAAAGG - Intronic
977104080 4:92858042-92858064 GAACACTATGTCTCCAAAAGTGG - Intronic
978099955 4:104826346-104826368 GTACCCCATGTGACCAAAACTGG + Intergenic
978770754 4:112454193-112454215 GCACATCATGAAACTAAAACAGG + Intergenic
979222296 4:118241803-118241825 TCACACTATGAAAACAAAAAAGG - Intronic
979487517 4:121285241-121285263 GCTCACAGTGTAAACAAAACAGG + Intergenic
980826371 4:138078493-138078515 GCACACTGACTAATCAAAACTGG + Intergenic
981213297 4:142134241-142134263 GTACATTATTTTACCAAAACAGG + Intronic
981287887 4:143041694-143041716 GCAAACTATGTATCCAACAAAGG + Intergenic
984066629 4:175055670-175055692 TCACACTATTTTACCAAAAATGG + Intergenic
986526134 5:8678436-8678458 GCAAACTATGCATCCAAAACAGG - Intergenic
988647519 5:33110455-33110477 GAATACTATGTAACCATAAAAGG - Intergenic
989080035 5:37608752-37608774 GCTCACTATGTAACCCAGGCTGG + Intronic
989505228 5:42218905-42218927 GGACACTAGGGAACCACAACTGG - Intergenic
990020302 5:51118373-51118395 GCATACTATGTATCCAACATAGG + Intergenic
991324779 5:65418640-65418662 GCAAACTATGCATCCAAGACAGG + Intronic
991374007 5:65947003-65947025 GCAAACTATATATCCAAAAACGG - Intronic
992510150 5:77424853-77424875 TCTCACTCTGTAACCCAAACTGG + Intronic
993894784 5:93521451-93521473 GCAAACTATGTACCCAACAGAGG + Intergenic
994397348 5:99235826-99235848 GCAAACTATGTATCCAACAAAGG + Intergenic
994985045 5:106922022-106922044 GAACACTATTTAACTAAAAAAGG + Intergenic
995878711 5:116819950-116819972 TCTCACTCTGTCACCAAAACTGG - Intergenic
996106037 5:119504679-119504701 TCACACTATGTATCCAATAGAGG - Intronic
996877780 5:128259007-128259029 ACAAACTATGTAAACAAAAAGGG - Exonic
999699072 5:154211538-154211560 CAGCACTATATAACCAAAACGGG - Intronic
1000264983 5:159627317-159627339 GCAAACTATGTATCCAACAAAGG + Intergenic
1006498157 6:34439024-34439046 GCACACAAGGCAACCCAAACAGG - Intergenic
1008264936 6:49413343-49413365 GCAAACTATGTACCCAACAAAGG - Intergenic
1009203431 6:60773544-60773566 TCTCACTATGTAACCCAAGCTGG - Intergenic
1010459380 6:76097038-76097060 GCAAACTATGCAACCAACAAAGG + Intergenic
1010762956 6:79745723-79745745 GCAAACTATGTATCCAACAAAGG - Intergenic
1011636450 6:89378957-89378979 TCTCACTATGTTACCTAAACTGG + Intronic
1012268018 6:97170809-97170831 TCTCACTATGTTACCAAAGCTGG - Intronic
1014348564 6:120309103-120309125 CCCCACAATGTAACTAAAACTGG + Intergenic
1015161905 6:130162156-130162178 ACACTCTATGTTGCCAAAACTGG - Intronic
1017246396 6:152231316-152231338 GCACACTCTGTAAGGAAGACTGG - Intronic
1018600250 6:165530373-165530395 GCAAACTATGCATCCAAAAAAGG + Intronic
1018993181 6:168690193-168690215 GCTCACTCTGTAACCAAGGCTGG + Intergenic
1019967256 7:4509840-4509862 GAACACTATGTAGCCATAAAAGG + Intergenic
1020368625 7:7408482-7408504 GCATAGTATGTAATCTAAACAGG - Intronic
1023509819 7:40939782-40939804 GCAAACTATGCATCCAAAAAAGG - Intergenic
1024493548 7:50015647-50015669 GCAAACTATGTATCCAACAAAGG + Intronic
1024733821 7:52281516-52281538 GCAAACTATGTATCCAACAATGG - Intergenic
1026625667 7:71989828-71989850 GCACACTATGGAACAGAAGCAGG + Intronic
1028951537 7:96641689-96641711 CCAAATTATGTTACCAAAACAGG - Intronic
1031268683 7:119616314-119616336 GCACATTATGTATCCAACAAAGG - Intergenic
1032466482 7:132148845-132148867 ACAAACTATGTGACCAAAATGGG + Intronic
1034518038 7:151596717-151596739 TCTCACTTTGTAACCAAAGCTGG - Intronic
1036449319 8:8852014-8852036 ACTCCCTATGTATCCAAAACTGG - Intronic
1036451684 8:8873102-8873124 GAACACTATGATACCAAAAATGG - Intronic
1039030582 8:33304911-33304933 GCAAACTATGCAACCAACAAGGG + Intergenic
1040617335 8:49050112-49050134 GCAAACTATGCATCCAAAAAAGG - Intergenic
1040689111 8:49912570-49912592 GCATACTATGTAACACAGACAGG - Intronic
1040944291 8:52866841-52866863 ACATACTATGTATCCAAAAAAGG - Intergenic
1042377579 8:68072255-68072277 ACTCACAATGTTACCAAAACAGG - Intronic
1043079429 8:75747239-75747261 GCAAACTATGCAACCAACAGAGG + Intergenic
1043080445 8:75759384-75759406 GCACACTATGTAAACATATAGGG - Intergenic
1043135234 8:76514970-76514992 GCAAACTATGCATCCAACACAGG + Intergenic
1044207156 8:89503763-89503785 GAACACTATGTAGCCATAAAAGG - Intergenic
1050782339 9:9353429-9353451 GCAAAGTATTTAACCTAAACTGG - Intronic
1058238402 9:102523276-102523298 GCAAACTATGCATCCAAAAGAGG - Intergenic
1058327061 9:103711604-103711626 GCAAACTATGTATCCAACAAGGG - Intergenic
1058571011 9:106344130-106344152 GCAAACTATGCATCCAAAATGGG + Intergenic
1060217775 9:121748792-121748814 CCACACCCTGCAACCAAAACAGG - Intronic
1060871609 9:127046638-127046660 TCTCACTATGTCACCAAAGCAGG - Intronic
1186830273 X:13383266-13383288 GCACGCTATGTTGGCAAAACAGG + Intergenic
1187063402 X:15809690-15809712 GCACACACTGTCCCCAAAACAGG + Intronic
1187549645 X:20289090-20289112 GGACACTATTTAACCAAATATGG + Intergenic
1188192834 X:27193432-27193454 GTTTACTATGTAACAAAAACTGG - Intergenic
1189719616 X:43902698-43902720 GCACAGAATGTAAGCAAATCTGG + Intergenic
1189945036 X:46169242-46169264 GCACACAGTGTCACCAACACAGG - Intergenic
1193003636 X:76591204-76591226 CCTCACAATGTAAACAAAACTGG - Intergenic
1193358142 X:80547217-80547239 GCAAACTATGTATCCAACAAAGG + Intergenic
1193874612 X:86846615-86846637 GCAAACAATGTCCCCAAAACTGG - Intergenic
1194875059 X:99176739-99176761 GCACACTATGTATCCAGCAAAGG + Intergenic
1196926342 X:120637027-120637049 GCAAACTATGTATCCAACAAAGG - Intergenic
1198388475 X:136149392-136149414 GAACCTTATGTAACCAAAAATGG - Intronic
1199932262 X:152535286-152535308 GCAAACTATGTATCCAACAAAGG - Intergenic
1200668911 Y:6062876-6062898 GCTCACTATATAACGAAAAAGGG - Intergenic
1201609513 Y:15825021-15825043 TCTCACTATGTTACCAAGACTGG - Intergenic
1202588807 Y:26460584-26460606 GCAAACTATGCAACCAACAAAGG - Intergenic