ID: 1110582400

View in Genome Browser
Species Human (GRCh38)
Location 13:77145931-77145953
Sequence TACTACCTACTAGTGAAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 115}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110582400_1110582401 -7 Left 1110582400 13:77145931-77145953 CCTATTTTCACTAGTAGGTAGTA 0: 1
1: 0
2: 0
3: 4
4: 115
Right 1110582401 13:77145947-77145969 GGTAGTATTATGTAATATATTGG 0: 1
1: 0
2: 1
3: 8
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110582400 Original CRISPR TACTACCTACTAGTGAAAAT AGG (reversed) Intronic
901681408 1:10914906-10914928 TACTGGCTCATAGTGAAAATGGG - Intergenic
903493625 1:23748889-23748911 TATTACTTACTACTGTAAATAGG + Intronic
905556713 1:38891409-38891431 GTTTACCTACTATTGAAAATGGG - Intronic
907093432 1:51751675-51751697 TACTGCCTTCTATTGAAGATTGG + Intronic
908407928 1:63833010-63833032 TACTACTTTCTTGTGGAAATGGG - Intronic
909528499 1:76654621-76654643 TACCACCTATTAGTAAAGATAGG + Intergenic
910391585 1:86750974-86750996 TTCTACCTGCTAGTGAAGACAGG + Intergenic
911709134 1:101048994-101049016 TATTGCATACTAGTGAAGATTGG - Intergenic
912084221 1:105978727-105978749 TACAAACTACTAATGAAAAGAGG - Intergenic
913276588 1:117144289-117144311 TACTACCAACTAGTGGATAGAGG - Exonic
916568205 1:166001062-166001084 AACCACCTACAAGTTAAAATAGG - Intergenic
917250841 1:173059146-173059168 TACTAGGTACTTGGGAAAATAGG + Intergenic
919496662 1:198280270-198280292 TGCTATCTACTAGTGATAAATGG - Intronic
920157230 1:203963697-203963719 TACTATCTATTATTGAAAATGGG - Intergenic
923879325 1:238086116-238086138 AATTACCAACTGGTGAAAATTGG + Intergenic
1062853215 10:761458-761480 TCCTACCTAGAAGTGAAAAGAGG + Intergenic
1064507965 10:16054507-16054529 TAGTACCTAATATTGAAATTTGG - Intergenic
1067264671 10:44729195-44729217 TCCTACCCACTATTAAAAATGGG + Intergenic
1067433020 10:46256342-46256364 ATCTTCCTAATAGTGAAAATAGG + Intergenic
1067440243 10:46305082-46305104 CTCTTCCTATTAGTGAAAATAGG - Intronic
1067517075 10:46959081-46959103 TTCTATCCACTAATGAAAATGGG + Intronic
1067645175 10:48092749-48092771 TTCTATCCACTAATGAAAATGGG - Intergenic
1067963267 10:50880463-50880485 TACTACCAACTAATTATAATTGG - Intronic
1071949405 10:90685555-90685577 TTTTACCTATTAGTGAATATTGG - Intergenic
1075463055 10:122631567-122631589 TACTTGCTACTGGTGACAATTGG + Intronic
1087970450 11:104474613-104474635 TAGTACTCACTAGTAAAAATTGG - Intergenic
1090529168 11:127572346-127572368 TTCTACCTATTACTGAGAATGGG - Intergenic
1096900441 12:54873583-54873605 TGCTATCTACTACTGAAAGTAGG - Intergenic
1098501218 12:71194305-71194327 TACTGCCTACTGATGAAAAAAGG + Intronic
1099254543 12:80299424-80299446 ACCTACATACAAGTGAAAATTGG - Intronic
1101048797 12:100839041-100839063 TTCTAACTAATAATGAAAATAGG - Intronic
1101188017 12:102301331-102301353 TTCTACCCATGAGTGAAAATTGG + Intergenic
1101871606 12:108570325-108570347 CCCTATCTTCTAGTGAAAATGGG + Intergenic
1103125111 12:118415228-118415250 TACTACCTACTTGGGAACAAGGG - Exonic
1103832749 12:123793297-123793319 TACAACCTAATGCTGAAAATAGG - Intronic
1104249364 12:127076621-127076643 TCATCCCTGCTAGTGAAAATTGG - Intergenic
1106298863 13:28444137-28444159 CACTATCTACTATTGAAAGTGGG - Intronic
1107209281 13:37833469-37833491 TCTTTCCTACTAGTGAAGATGGG + Intronic
1109349994 13:61167469-61167491 TACAACATTCTACTGAAAATAGG - Intergenic
1109966797 13:69710367-69710389 TGTTACCTACTACTGAAAACAGG - Intronic
1110582400 13:77145931-77145953 TACTACCTACTAGTGAAAATAGG - Intronic
1111196440 13:84880641-84880663 AACTACCTACTAAATAAAATTGG - Intergenic
1114736901 14:25050976-25050998 TACTAGTTACTAGGGGAAATGGG + Intergenic
1114829697 14:26125692-26125714 TGCTACCTACTAGTGATTAGTGG - Intergenic
1116176553 14:41477953-41477975 TACTACCTAAAATTGAACATAGG - Intergenic
1120593982 14:86411786-86411808 TCCTAACTAGTAGTCAAAATTGG - Intergenic
1125434507 15:39630609-39630631 AACTACCTAGTGGGGAAAATTGG + Intronic
1130780505 15:87033484-87033506 TCCTAACTAATAATGAAAATAGG + Intergenic
1131502872 15:92987042-92987064 TTCTACCCATTATTGAAAATGGG + Intronic
1135101247 16:19608035-19608057 TACTTCCTAATAGTGATATTTGG + Intronic
1138895753 16:61202166-61202188 TAATACATACTGGTGAATATAGG - Intergenic
1145822636 17:27851354-27851376 TGCCACCTGCTAGTCAAAATCGG - Intronic
1146279623 17:31536807-31536829 TGCTACCCACCAGAGAAAATAGG + Exonic
1147228478 17:38999624-38999646 TACTACATAAAAGTGAAAAAGGG - Intergenic
1157199160 18:45644115-45644137 TACTACCTGACAGTGAAAAGCGG + Exonic
1163873149 19:19842475-19842497 TACTCACTACTAGTCAACATGGG - Intergenic
1164547940 19:29184542-29184564 TAATAACTACTAATGAAAGTGGG + Intergenic
1165103547 19:33455231-33455253 TAATACATAATAGGGAAAATGGG + Intronic
925224922 2:2175417-2175439 GATTAGCTACTAGTGGAAATGGG + Intronic
929130197 2:38560236-38560258 AACTACCTAGTAGAGAAAAATGG - Intergenic
933316143 2:80718085-80718107 TATTATATAATAGTGAAAATAGG - Intergenic
936933330 2:117812997-117813019 TTCTAGCTAGTAGTGAAGATTGG - Intergenic
938840447 2:135157128-135157150 TCCTAGCTACTAGGGAAACTGGG - Intronic
939454765 2:142419820-142419842 TACTTCCTAATTGTGAAATTAGG + Intergenic
940147180 2:150558509-150558531 TACTGCCTACTACTTATAATCGG + Intergenic
940619828 2:156097530-156097552 CACTACCAACTGGTTAAAATTGG + Intergenic
941100976 2:161294891-161294913 TTTTACCTACTAGTGAAATCTGG + Intergenic
942591756 2:177553565-177553587 TTCTACCTAGTAGTGAAAGTTGG - Intergenic
1169611253 20:7382451-7382473 AACTACCTAGTAGTGCAAAAAGG + Intergenic
1170481019 20:16764882-16764904 CACTACCCACTAGTGGAACTTGG + Intronic
1176205307 20:63885056-63885078 TACTTCCTGAAAGTGAAAATTGG + Intronic
1178286970 21:31334029-31334051 TACTACGTAGAGGTGAAAATCGG + Intronic
949414912 3:3803229-3803251 TACTAGGTACTAAAGAAAATCGG + Intronic
951738510 3:25894702-25894724 TACTAGATTCTAGTGAGAATGGG - Intergenic
954896616 3:53980430-53980452 TACAACCTACTAGAGGCAATGGG + Intergenic
956581974 3:70824066-70824088 AACTACCTTCTAATGAAGATTGG + Intergenic
959729674 3:109586562-109586584 TCCTCCCTAGGAGTGAAAATTGG - Intergenic
959887533 3:111519892-111519914 TTTAACCTACTAGTGAAATTGGG + Intronic
963254525 3:143131552-143131574 TCCTACCTACAAGGGAAACTGGG - Intergenic
966843163 3:184105849-184105871 TTCTACCTGCCAGTGAAAAGTGG + Exonic
967336843 3:188353349-188353371 TACTAATTGCTGGTGAAAATTGG + Intronic
978333136 4:107636959-107636981 TACTATCTAATAGTGAGAATAGG + Intronic
979970713 4:127131163-127131185 TTCTGCCTAATAGTGAAAAGAGG + Intergenic
984426049 4:179586761-179586783 TGATCCCTACTATTGAAAATGGG - Intergenic
984548887 4:181137783-181137805 GAATACCTATGAGTGAAAATGGG + Intergenic
985000929 4:185481859-185481881 TACTTATTACTAGTGAATATTGG + Intergenic
989016835 5:36945919-36945941 TACTACTTACTATTTTAAATAGG - Intronic
989397113 5:40969058-40969080 TAATACCTAATAGGGAAACTGGG - Intronic
992867465 5:80972033-80972055 TACTACCTATAAATGAAAAGGGG - Intronic
994389927 5:99180380-99180402 TATTACCTACTAGTGAAGTATGG + Intergenic
995257394 5:110062759-110062781 TTCTACCTTCTCTTGAAAATAGG + Intergenic
997769162 5:136537629-136537651 TTCTATCCACTATTGAAAATGGG - Intergenic
1002116350 5:176963217-176963239 TAATACTTAAAAGTGAAAATGGG + Intronic
1002257963 5:177973061-177973083 TACTACCTACTTGGGAACAAGGG - Intergenic
1003393506 6:5733293-5733315 GAATACCCACAAGTGAAAATGGG + Intronic
1005627519 6:27677307-27677329 TACTACTTCCTGGAGAAAATGGG - Intergenic
1015033081 6:128619584-128619606 TACTACGTAGTAGTGAAATGAGG + Intergenic
1028023373 7:85806522-85806544 TACTGCCTACTAGTGGCAAATGG + Intergenic
1032019267 7:128397789-128397811 TACTGCATACTGGTGAGAATTGG + Intronic
1032160410 7:129505240-129505262 TACTATTAACTAGTGAAAAGTGG + Intronic
1033615950 7:143014219-143014241 TAGTACCTGCTAGTGCACATTGG + Intergenic
1038171516 8:25137999-25138021 TTCGACCCACTATTGAAAATGGG - Intergenic
1043089703 8:75883031-75883053 TAATACCAACTAGTGAAAACTGG + Intergenic
1044025431 8:87165328-87165350 ATCTATCTAATAGTGAAAATGGG + Intronic
1045843172 8:106603010-106603032 TAATACCCAGTGGTGAAAATGGG - Intronic
1046142512 8:110113040-110113062 TAATACCTAATTGTGAAATTTGG + Intergenic
1050952107 9:11610661-11610683 TACTACCACCTAGTGCAACTTGG + Intergenic
1050982536 9:12037980-12038002 TACTAACCTCTAGTGTAAATGGG + Intergenic
1051260584 9:15260420-15260442 TATTACCTACAGGGGAAAATTGG + Intronic
1052710168 9:32044553-32044575 TACAACCTATAAGTCAAAATAGG + Intergenic
1053472933 9:38359761-38359783 TACTCCCAACTAGTCAAAGTTGG - Intergenic
1053716320 9:40894796-40894818 TACAATCTACAAGTGGAAATTGG + Intergenic
1055059364 9:72052977-72052999 TCCTACCTACAACTGAAACTGGG - Intronic
1056032938 9:82571803-82571825 AACTACCTACTAGAGAGACTGGG - Intergenic
1058124648 9:101177759-101177781 TACAACCTAATAGAAAAAATGGG - Intronic
1185507263 X:640624-640646 GACTACCTAGTACTGGAAATTGG - Intronic
1186157953 X:6745526-6745548 TACTACCTCTAAATGAAAATTGG + Intergenic
1191225844 X:58042349-58042371 TACTACCATTTATTGAAAATGGG + Intergenic
1194747678 X:97646876-97646898 TTCTACCCATTATTGAAAATGGG + Intergenic
1201551574 Y:15222484-15222506 TACTACCTCTAAATGAAAATTGG + Intergenic