ID: 1110583101

View in Genome Browser
Species Human (GRCh38)
Location 13:77155875-77155897
Sequence AGGTGTAACTTGGACACTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 100}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110583094_1110583101 24 Left 1110583094 13:77155828-77155850 CCCCGTAACAGGTAGCAAAATGT 0: 1
1: 0
2: 1
3: 7
4: 76
Right 1110583101 13:77155875-77155897 AGGTGTAACTTGGACACTTGGGG 0: 1
1: 0
2: 1
3: 9
4: 100
1110583095_1110583101 23 Left 1110583095 13:77155829-77155851 CCCGTAACAGGTAGCAAAATGTA 0: 1
1: 0
2: 2
3: 9
4: 172
Right 1110583101 13:77155875-77155897 AGGTGTAACTTGGACACTTGGGG 0: 1
1: 0
2: 1
3: 9
4: 100
1110583096_1110583101 22 Left 1110583096 13:77155830-77155852 CCGTAACAGGTAGCAAAATGTAA 0: 1
1: 0
2: 5
3: 20
4: 200
Right 1110583101 13:77155875-77155897 AGGTGTAACTTGGACACTTGGGG 0: 1
1: 0
2: 1
3: 9
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110583101 Original CRISPR AGGTGTAACTTGGACACTTG GGG Intronic
905347821 1:37323413-37323435 AGGGGCAACCTGGAGACTTGGGG - Intergenic
913262580 1:117012928-117012950 GAGTATAACTTGGATACTTGAGG - Intronic
915437767 1:155921791-155921813 ATGTGTAACTATGATACTTGAGG - Intronic
917727015 1:177837898-177837920 AGATGTAACTGGGGCACATGAGG - Intergenic
920129735 1:203722803-203722825 AGCTGTAAGTTGAACACTTTGGG + Intronic
921149120 1:212385841-212385863 GGATGTGACTTGCACACTTGGGG - Intronic
921293819 1:213683658-213683680 AGGTGGAACTCGGACAGTTAGGG - Intergenic
921591251 1:217006778-217006800 AGGTGTAAATTTTCCACTTGTGG + Intronic
921772086 1:219052211-219052233 AAGTGGCACTTGGACACTTCAGG + Intergenic
921879629 1:220240217-220240239 AGTTGTAACATGGCCACTTTAGG - Intronic
922594214 1:226801379-226801401 AGTTGTAACTTGGGCACCTAAGG + Intergenic
1063539306 10:6916017-6916039 AGGTGTAACTCAGCCATTTGGGG - Intergenic
1065804682 10:29383540-29383562 AGGTTTATTTTGCACACTTGAGG + Intergenic
1066277566 10:33884075-33884097 AGGAGTAACTTGGAAATTTCTGG - Intergenic
1072410042 10:95193505-95193527 AGGTGTAACTTGGTTACTGGTGG - Intergenic
1076135586 10:128043567-128043589 ATGTAGAAGTTGGACACTTGGGG + Intronic
1080638293 11:34142582-34142604 AGGTGTGACCTGGAGCCTTGGGG - Intronic
1092083423 12:5736548-5736570 AGATGTTACTTGGGCACTGGAGG - Intronic
1098643598 12:72869248-72869270 ATGTGGAACTTGGACACTCAAGG - Intergenic
1100102856 12:91130523-91130545 AGGAGTAACTTGGATACTAGAGG - Intergenic
1101448971 12:104759098-104759120 AGGTGAGACTCGTACACTTGGGG + Exonic
1103403643 12:120659907-120659929 AGGTAAAACTTGGCCCCTTGGGG + Exonic
1106834932 13:33624348-33624370 AGGGTGATCTTGGACACTTGTGG + Intergenic
1108860746 13:54855582-54855604 ATGTGAAACGTGGACACTTGAGG + Intergenic
1110185225 13:72666556-72666578 AGGTGGAAGCTAGACACTTGGGG + Intergenic
1110583101 13:77155875-77155897 AGGTGTAACTTGGACACTTGGGG + Intronic
1112217009 13:97441975-97441997 ATTTGTTACTTTGACACTTGTGG + Intronic
1112712457 13:102145592-102145614 AGGTGTAACTGGTACACTGAAGG - Intronic
1112794510 13:103041380-103041402 GCGTGTAACTTGGAAATTTGAGG - Intergenic
1113129901 13:107024079-107024101 AGGATTAACATGGACACATGTGG - Intergenic
1118470446 14:66070136-66070158 AGGTGCAAAGTGGACACATGGGG + Intergenic
1120782580 14:88499042-88499064 AAGTGTCACATGGAAACTTGAGG - Intronic
1124653502 15:31489393-31489415 GGGTGCAACTTGGACATTTTGGG + Intronic
1125380360 15:39080565-39080587 AGGAGGACCTTGGCCACTTGAGG + Intergenic
1128245044 15:66127379-66127401 TGGGGTAGCCTGGACACTTGTGG - Intronic
1130848194 15:87767206-87767228 AGGTGAAACTAGGACTCTTCTGG - Intergenic
1132997706 16:2831801-2831823 AGGTGAAACTTGGAGACTCCTGG + Exonic
1133125947 16:3646145-3646167 AGGTGGCACTTGGACACTCTGGG - Intronic
1134310256 16:13070036-13070058 GGGTGTCACTTGGAAATTTGGGG + Intronic
1134843429 16:17420173-17420195 AGCTATAATTTGGGCACTTGTGG - Intronic
1142330266 16:89447600-89447622 AGGTGGAATGTGGACACTTAGGG - Intronic
1143654408 17:8285536-8285558 AGTTGGAATTTGAACACTTGAGG + Intergenic
1150154189 17:62836694-62836716 AGTTGAAACTTGGACATTTTTGG - Intergenic
1150976945 17:70098220-70098242 GGGTGTAAATTGCACCCTTGGGG + Intronic
1151619142 17:75234575-75234597 AGGTGTCACTTGGGCAATTTGGG + Intronic
1155498735 18:26466454-26466476 AGGAGTAATTTTGACACTAGAGG + Intronic
1157139394 18:45090520-45090542 AGGTGTAACTTAAAGATTTGAGG - Intergenic
1158327617 18:56327949-56327971 ATGTGGAATGTGGACACTTGGGG + Intergenic
1161757302 19:6143600-6143622 AGGTGTCACCTGGACACTTGTGG - Intronic
1164022055 19:21316510-21316532 AGGTATTACTTGCACATTTGTGG + Intronic
1164094680 19:21996645-21996667 AGGTGTTACCTGAACATTTGTGG + Intronic
1164183624 19:22841815-22841837 AGGTGTTACTTGCATATTTGTGG - Intergenic
1166838842 19:45683892-45683914 ACATGTAACATGGCCACTTGGGG - Intergenic
928433461 2:31238962-31238984 TCGTGTGACTTGGACTCTTGAGG + Intronic
929504310 2:42516450-42516472 AGGAGTAACCTGGACACCTATGG - Intronic
929863664 2:45699991-45700013 AGGTGTAAATTGGGCTGTTGAGG + Intronic
930699610 2:54446180-54446202 AAGTGAGACTTGGACACTTCAGG + Intergenic
931048093 2:58379867-58379889 GGGTATCACTTGGTCACTTGGGG - Intergenic
937053435 2:118910997-118911019 ACATGTAACTTGTACTCTTGGGG + Intergenic
944529721 2:200655527-200655549 AGGAGAAACTTAGACTCTTGAGG - Intronic
944827589 2:203501075-203501097 AGTTGTAACTTGCACAGTTGGGG - Intronic
945179679 2:207079157-207079179 AGCTGCCAATTGGACACTTGGGG - Exonic
945370688 2:209013229-209013251 GGGTGTAAATTACACACTTGAGG + Intergenic
1173803577 20:45910204-45910226 AAGTCTAAGTTGGGCACTTGAGG - Intronic
1178864953 21:36319827-36319849 AGGTTTCACATGGACACTGGTGG + Intergenic
1180748653 22:18110105-18110127 AGATGTGACTTGGACACGTTTGG + Intronic
1185057274 22:48587607-48587629 AGGTGTCCCTGGGACACTTCAGG - Intronic
950058803 3:10051555-10051577 AGCAGTAACTTGAAGACTTGGGG + Intronic
950093248 3:10312221-10312243 AGCTGTAACTTGGTCAACTGAGG + Intronic
950300448 3:11872822-11872844 AGCAGTAACTTGAAGACTTGGGG + Intergenic
954021245 3:47743913-47743935 AGTCCTAACCTGGACACTTGAGG - Intronic
956598244 3:70992184-70992206 TGATTAAACTTGGACACTTGGGG - Intronic
961515948 3:127435946-127435968 AGGTGTAACTTGCACACAAAAGG - Intergenic
965652751 3:170950802-170950824 AGCTGCCAATTGGACACTTGGGG - Intergenic
967853552 3:194099931-194099953 AGGTGTAACATGGCCACCAGTGG - Intergenic
975839829 4:78461988-78462010 AAGCGTAAGTTGGAAACTTGGGG + Intronic
980455770 4:133040614-133040636 TGGTGCAAGTTGGACACATGCGG - Intergenic
981785530 4:148474618-148474640 AATTGTAACTTGGAGACTTTAGG - Intergenic
982097746 4:151938161-151938183 AGGTGTGCCTTTGACATTTGTGG + Intergenic
991298436 5:65104498-65104520 AGGTGTGACTCTGACACTTTTGG - Intergenic
993522431 5:88919977-88919999 AGCGGTAACAAGGACACTTGTGG - Intergenic
999447654 5:151653186-151653208 AAGTGTATCTTGGACATGTGGGG + Intergenic
1000864806 5:166500577-166500599 AGGTGAAACTTGGGCAGTTGGGG + Intergenic
1001309917 5:170603294-170603316 AGGTGTGATTTGGACCATTGAGG - Intronic
1002527737 5:179824210-179824232 AGGTGAAACACGGACACTTCGGG + Exonic
1003355895 6:5369518-5369540 AGGTGCAACATGGAAACCTGTGG + Intronic
1004365617 6:15010275-15010297 AGGTTTAACTTGGAAAATTGGGG - Intergenic
1005192561 6:23242621-23242643 AGGTGTAACTGGGCCAAGTGTGG + Intergenic
1006260651 6:32866434-32866456 AGGTGTTACTGGGACAATAGGGG + Intergenic
1006968384 6:38013747-38013769 AGGTGTAACCTGGACATTGGAGG - Intronic
1007032574 6:38641256-38641278 AATAGTAACTTAGACACTTGTGG - Intergenic
1007039956 6:38712453-38712475 AGGTGTAACCTGGCCACCTTGGG + Intergenic
1008068929 6:47079727-47079749 TGGTGTAGCTTGAACACTCGGGG + Intergenic
1016512943 6:144863897-144863919 AGGTGTACCTTGGCCCCTTTAGG - Intergenic
1024913182 7:54469464-54469486 AGCTGAAACCAGGACACTTGAGG - Intergenic
1027974566 7:85134844-85134866 ATATGTTCCTTGGACACTTGGGG - Intronic
1033652393 7:143352875-143352897 GGGAGTAACCTGGACACTGGAGG - Intergenic
1034596731 7:152202666-152202688 AGATGTAACAAGGACACTTTGGG - Intronic
1038891770 8:31733624-31733646 AGGTGTAACCTGGACTTTTCTGG - Intronic
1041319170 8:56595886-56595908 AGGAGTAAGTGGGACATTTGGGG - Intergenic
1041855707 8:62452154-62452176 AAGGGAAACTTGGACACTTTTGG - Intronic
1043601555 8:81944907-81944929 AAATGTAACTTAGACACTTTAGG + Intergenic
1044933134 8:97269379-97269401 AGGGGTAACTGGGAGACCTGGGG + Intergenic
1045038504 8:98197136-98197158 AGGTGTATCTTGGAGATATGTGG + Intronic
1045625387 8:104041969-104041991 AGCTGAAACTTGAACACATGTGG + Intronic
1050850357 9:10277742-10277764 AGGTGATTCTTTGACACTTGAGG - Intronic
1057222358 9:93264063-93264085 CGGTGTTTCTTGGACACGTGTGG + Intronic
1190447789 X:50546959-50546981 AGTTGAAACTTGGACATTTGGGG - Intergenic
1190447820 X:50547221-50547243 AGTTGAAACTTGGACATTTGAGG - Intergenic
1200020019 X:153195435-153195457 AGGTGGAAACAGGACACTTGGGG + Intergenic
1200910885 Y:8530469-8530491 AGAGGTGATTTGGACACTTGTGG - Intergenic