ID: 1110588257

View in Genome Browser
Species Human (GRCh38)
Location 13:77221289-77221311
Sequence CCCAAGTCTGAAGAGATATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 5, 3: 23, 4: 153}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110588257_1110588260 -10 Left 1110588257 13:77221289-77221311 CCCTATATCTCTTCAGACTTGGG 0: 1
1: 0
2: 5
3: 23
4: 153
Right 1110588260 13:77221302-77221324 CAGACTTGGGAATCGAAGAATGG 0: 1
1: 0
2: 0
3: 14
4: 139
1110588257_1110588262 10 Left 1110588257 13:77221289-77221311 CCCTATATCTCTTCAGACTTGGG 0: 1
1: 0
2: 5
3: 23
4: 153
Right 1110588262 13:77221322-77221344 TGGTGTTCACTGGTATAATCAGG 0: 1
1: 0
2: 2
3: 32
4: 389
1110588257_1110588261 0 Left 1110588257 13:77221289-77221311 CCCTATATCTCTTCAGACTTGGG 0: 1
1: 0
2: 5
3: 23
4: 153
Right 1110588261 13:77221312-77221334 AATCGAAGAATGGTGTTCACTGG 0: 1
1: 0
2: 0
3: 1
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110588257 Original CRISPR CCCAAGTCTGAAGAGATATA GGG (reversed) Intronic
904369997 1:30042340-30042362 CCCAAGAATGCAGAGATATCTGG - Intergenic
905447426 1:38036140-38036162 CCTAACTCTGAAGTCATATAGGG - Intergenic
909598888 1:77440508-77440530 CCCAAGTCTGAGGGGATATATGG - Intronic
910210612 1:84788976-84788998 CCCAGGGCTGAAGAAATAAAAGG + Intergenic
913687367 1:121245405-121245427 CCAGAGTCTTAAGACATATAGGG - Intronic
914039229 1:144033050-144033072 CCAGAGTCTTAAGACATATAGGG - Intergenic
914150229 1:145034886-145034908 CCAGAGTCTTAAGACATATAGGG + Intronic
914863202 1:151403683-151403705 CCTAAGTATTAAGAGAAATAGGG + Exonic
915838703 1:159198580-159198602 GCCAAGCCTGAGGAGACATAAGG + Intronic
918596603 1:186301390-186301412 CCCAAGTCAAAAAAGAAATATGG - Intronic
919313159 1:195937402-195937424 CCCAAGTATGAAGAAATTGAAGG + Intergenic
920474695 1:206263925-206263947 CCAGAGTCTTAAGACATATAGGG - Intronic
922975192 1:229778286-229778308 CCCAATTCTGAACAGGAATATGG + Intergenic
923162214 1:231324256-231324278 CCCAATCCTGAAGATATCTAGGG + Intergenic
923395890 1:233562234-233562256 TCCAAGTCTTCAGAGAGATATGG + Intergenic
924610703 1:245571357-245571379 CCCAGCTCTGAAGAGTTATTTGG + Intronic
1062948077 10:1475738-1475760 CTGAAGTTTGAAGAGAGATAGGG + Intronic
1065511048 10:26478728-26478750 ACCAAGGCTGAAGAGAAATGAGG + Intronic
1067215416 10:44298443-44298465 CCAAAATCTGAAGTAATATAAGG + Intergenic
1068275012 10:54783596-54783618 CCCAAGTCTTCAGAGAGATATGG + Intronic
1068663165 10:59645288-59645310 CCCAAGTCTTGGGAGAGATATGG - Intergenic
1073210535 10:101798108-101798130 GCCAAGTTTGAAGAGATGTGTGG - Exonic
1075989992 10:126827629-126827651 CCCAAGTCTTGGGAGATATATGG + Intergenic
1077809686 11:5624738-5624760 GCAATGTCTGAAGAGATATTTGG - Intronic
1081582124 11:44359653-44359675 CCCAACTCTGAAGAGACACCTGG + Intergenic
1081985901 11:47303969-47303991 CCCAAGTCTGGGGAGAGAGATGG - Intronic
1083613494 11:64015379-64015401 CCCAAGTCTGAAGACCTAGCTGG - Intronic
1089569830 11:119398164-119398186 CCCAAGTCTTAGGAGAGAAATGG + Intergenic
1090000305 11:122950537-122950559 TCCAAGTCATAAGAGATATTGGG - Intronic
1090137103 11:124209981-124210003 CCCAAGTCTGCAGAGATGCCTGG + Intergenic
1090918070 11:131184361-131184383 CCCATGACTGAGAAGATATAAGG + Intergenic
1092013267 12:5134724-5134746 CCCATGGGTGAAGAGATGTAAGG + Intergenic
1093710826 12:22328014-22328036 GCCAAGTCTGGAGACATATTTGG + Intronic
1094703639 12:32894862-32894884 CCTAAGTCTAAATAAATATAAGG + Intronic
1094796820 12:33983793-33983815 TCCAAGTTTGAAGATAGATATGG - Intergenic
1096845654 12:54405102-54405124 CCCAAGTCAGAAGGGATTTGGGG - Intronic
1098051643 12:66460296-66460318 CTGCAGTCTCAAGAGATATATGG + Intronic
1100394250 12:94170983-94171005 CCCAAATCTGAAGAGATAATTGG - Intronic
1101041107 12:100756716-100756738 CCCACGTCTGAAGAGCTTCAAGG - Intronic
1108261880 13:48666435-48666457 CCCAAGTCTTGAGAGAGAGATGG - Intronic
1109675467 13:65670491-65670513 CCCAAGTCTTGTGAGAGATACGG - Intergenic
1110588257 13:77221289-77221311 CCCAAGTCTGAAGAGATATAGGG - Intronic
1110731260 13:78881166-78881188 CCAAAGGCTGAAAAGATACAGGG - Intergenic
1111376854 13:87391556-87391578 CCCAAATCTTTAGAGAGATATGG + Intergenic
1112346689 13:98596159-98596181 CCCATCTCTAAAGAGAGATAGGG - Intergenic
1116352896 14:43888138-43888160 TCCATGTCTGAAGACATTTATGG - Intergenic
1117713676 14:58558886-58558908 CTCAAACCTGAAGAGATATCAGG - Intergenic
1117918246 14:60701382-60701404 CCCAAGTCTGGGGAGAGAGATGG - Intergenic
1118179077 14:63472966-63472988 ACCAAGTATGAAGAGTTATGAGG + Intronic
1118491691 14:66267282-66267304 ACCAAGTCTGAAGAGCTGTCAGG + Intergenic
1119959944 14:78843836-78843858 CCCAAGTCTGCATTGACATAAGG + Intronic
1121325747 14:93018708-93018730 GCCAAGTCTCAGGAGATATTGGG - Intronic
1123168773 14:106351338-106351360 CTGAAATCTGAAGAGAGATAAGG + Intergenic
1126286672 15:47020348-47020370 CCCAAATCTTAGGAGAAATAAGG + Intergenic
1127997137 15:64159808-64159830 CCCCATTCTGAAGAGGTATCAGG + Intronic
1128719185 15:69933623-69933645 CCCAAGGCAAAAGACATATATGG - Intergenic
1130901412 15:88209582-88209604 CCCCAGGCTGAAGGGATAAAAGG + Intronic
1132037567 15:98499461-98499483 CCCAAGTCTGAGGAGAGATATGG - Intronic
1132993394 16:2809478-2809500 CCCAAGTCTGGAGAGAGATATGG - Intergenic
1133686606 16:8171018-8171040 CCCAAGTCTGAGGAGACAGTGGG - Intergenic
1135679322 16:24443274-24443296 CCCAAGCCTGAAGCTATCTAGGG - Intergenic
1142334072 16:89475724-89475746 CCCAAGTTTAAAGAGGGATAAGG + Intronic
1146108485 17:30064625-30064647 CCCAAGTCTGGGGAGATATATGG + Intronic
1146798940 17:35803541-35803563 CCCAAGACTCAAGAGATGGAGGG + Intronic
1146828127 17:36041653-36041675 CCCAAGACTCAAGAGATGGAGGG - Intergenic
1149200420 17:54179178-54179200 CATAAGTCTGAAAATATATAGGG + Intergenic
1150250723 17:63703037-63703059 CCCAAGCCAGAAGAGGGATAAGG + Exonic
1150606832 17:66699010-66699032 CCCAAGTTTGGAGAAAGATATGG + Intronic
1153705775 18:7744144-7744166 CTCAAATCTGTAGAGATATGTGG - Intronic
1157973885 18:52303066-52303088 CCCAGATCTGGAGAGAGATATGG + Intergenic
1158258329 18:55579171-55579193 CCTAAGTATTAAGAGAGATATGG + Intronic
1158408693 18:57185405-57185427 CCCAAGTCTTGGGAGAGATATGG - Intergenic
1159616481 18:70585852-70585874 CCCAAATCTGAGAAAATATATGG + Intergenic
1162964195 19:14148360-14148382 TCCGAGTCTGGAGAGATACAAGG + Exonic
1165279301 19:34782972-34782994 CCCAATTCAGAGGAGATATCAGG + Intergenic
1167702197 19:51055884-51055906 CCCTAGTCTCTAGAGTTATAGGG - Intergenic
1168351292 19:55677652-55677674 CCCAAGGCTCAGGAGAGATAAGG - Exonic
1168551476 19:57299792-57299814 CCCAAGTCTTGCGAGAGATATGG - Intergenic
931567738 2:63632833-63632855 CCCAAGTCTGGGGATATGTATGG + Intronic
937846584 2:126585290-126585312 CCCAAGACTTCAGAGGTATAGGG + Intergenic
939846480 2:147252574-147252596 CCCAGGTCTGAGGAGTTGTAGGG - Intergenic
941306127 2:163869680-163869702 CCTAATTCTGTAGAGATATGTGG + Intergenic
945435737 2:209815350-209815372 CCCAGGTCTGAAGAAAGATCTGG - Exonic
945861007 2:215122312-215122334 ACCAATTCAGAAGAGATAAAAGG + Intronic
947883854 2:233546559-233546581 CCTAAGACTGAAGAGAGACACGG + Intronic
1176933301 21:14840045-14840067 CGCAGGACTGATGAGATATAAGG - Intergenic
1179791292 21:43757373-43757395 CCCACGGCTGGAGAGAAATAGGG + Exonic
1182019200 22:27066711-27066733 CCCAAGAGTCAAGAGAGATAAGG + Intergenic
950968344 3:17162231-17162253 CTCAAGTCTAATGAGATATATGG + Intronic
951241671 3:20293852-20293874 CCCAGGTCTAGAGAGAGATATGG - Intergenic
951283101 3:20776861-20776883 CTCAAGTCTGAAGGGACAGAGGG + Intergenic
956121962 3:65975445-65975467 CCCAAGTCTGAATTGAAAGATGG + Intronic
957695406 3:83631714-83631736 CCCTATTCTGGTGAGATATACGG + Intergenic
958042764 3:88245841-88245863 TCCAAGGCAGAAGAGATATATGG - Intergenic
959200576 3:103241456-103241478 CCCCATTCTGAAGAGAGATCAGG + Intergenic
959449212 3:106478953-106478975 CCCAAGTTTTTAGAGAGATATGG - Intergenic
962117993 3:132532550-132532572 ACCAAATCTGAAGAGAGATATGG - Intronic
963878992 3:150506337-150506359 CCCAAGTCTTAGGAGAGGTATGG + Intergenic
964605240 3:158553619-158553641 CCTAGGTCTGAAGAGGTATAAGG - Intergenic
964636937 3:158868467-158868489 ACCAAGTCTGATGAACTATAAGG - Intergenic
965972093 3:174571895-174571917 AACAAGTCTGAAGAAATATTGGG - Intronic
970142336 4:12996175-12996197 CCCATATCTGCAGGGATATAGGG - Intergenic
971587984 4:28430469-28430491 CCAAAGTATCCAGAGATATAAGG - Intergenic
974854006 4:67437834-67437856 CCCATGTCTGAAAAGTTATCAGG - Intergenic
975448602 4:74498792-74498814 CCCAAGTGTGAGGAGAGATATGG - Intergenic
976073411 4:81269419-81269441 TCCAAGTCTGGAGAGAGATATGG - Intergenic
976963724 4:91010446-91010468 CCCAAGTCTTCAAAGAGATATGG - Intronic
977248684 4:94664208-94664230 ACCAAGTCTGAGGAAATATTTGG + Exonic
980152022 4:129059883-129059905 CCCAAGGCTGTGGAGAGATATGG - Intronic
981526511 4:145711437-145711459 CCCAAACCTGGAGAGAGATACGG - Intronic
984520444 4:180795807-180795829 CCCATGTATGAAGAGATTCAAGG + Intergenic
984636792 4:182119535-182119557 CCCAAATTTGGAGAGATAAATGG - Intergenic
987152229 5:15055103-15055125 CCCAAGTTTTAAGAGAGATATGG - Intergenic
988596278 5:32594387-32594409 CCTAACTCTGAAGAAAAATATGG - Intronic
989386324 5:40858222-40858244 CCCCAGTCAGAAGAGCTGTATGG + Intronic
990594291 5:57297667-57297689 TCCAAATGTGAAGAGATACATGG + Intergenic
991241033 5:64459896-64459918 CCCAAGTCTGGGGAGAGATATGG + Intergenic
991938382 5:71826442-71826464 CCCAAGTCTTGAGAGAGATATGG - Intergenic
993500827 5:88664974-88664996 CTCCAGTCTGAAGTCATATAAGG + Intergenic
993658761 5:90604006-90604028 CCCTAGTCTGAGGAGACATTAGG + Intronic
994199863 5:96960610-96960632 CACTAGTCTGAAGAGATTTATGG - Intronic
994734693 5:103538088-103538110 AGCAAGTCTGAAGTGATATATGG - Intergenic
995749557 5:115439994-115440016 CCCAAATCTGAGGAGAGATATGG - Intergenic
997364660 5:133318299-133318321 CTCAAGTCTGTAGAGCTACAGGG + Intronic
997364792 5:133318972-133318994 CTCAAGTCTGTAGAGCTACACGG + Intronic
997841575 5:137245673-137245695 CTCAAGTCTCAAGGGATGTACGG + Intronic
998026028 5:138817451-138817473 CCCAAGTCTGGGGAGAGATATGG - Intronic
998042072 5:138957126-138957148 CCCACCTCTGAGGAGATAAAGGG + Intronic
998321339 5:141235396-141235418 CCCACGTCTCCAGAGATGTACGG + Intergenic
998377020 5:141698039-141698061 CCCATGTCAGAACAGATAAAAGG - Intergenic
1000773732 5:165389974-165389996 CTCAAGTCTTAGGAAATATATGG + Intergenic
1002551881 5:180000430-180000452 CCCAAGTCTACGGAGATATATGG - Intronic
1007191071 6:40019111-40019133 CCCAAATCTGGAGAGGAATATGG + Intergenic
1007439702 6:41847889-41847911 CCCAAATCTAAGGAGATAAATGG + Intronic
1007990576 6:46251180-46251202 CCCAAGGCTTAAGAGATGAAGGG - Intronic
1008848221 6:55993841-55993863 CCCAAGTCTGAAGAGAGCAGAGG + Intergenic
1010630877 6:78196447-78196469 CCCAAGTCTGTCTAGATTTATGG + Intergenic
1012521879 6:100131120-100131142 CCCAAATCTTGGGAGATATATGG - Intergenic
1012535867 6:100296132-100296154 CCCAAGTCAGAAGAGGTATGTGG - Intergenic
1013340693 6:109212668-109212690 CCCAAGTCTTAGGAGAGATATGG - Intergenic
1013876439 6:114836165-114836187 TCCAAGTCAGAAGAGAAGTAGGG - Intergenic
1017039320 6:150295110-150295132 TCCAAGTCTGAAGAGACAAAGGG + Intergenic
1017553684 6:155540045-155540067 CTCAAGTCTGAAGAGAGACATGG + Intergenic
1018363719 6:163097869-163097891 CCCAGTCCTGAAGAGATTTACGG - Intronic
1022450705 7:30512037-30512059 AGCAAGTCTGAAGAGTTATATGG + Intronic
1023945425 7:44798951-44798973 CCTACTTCTGAAAAGATATATGG - Intronic
1026507416 7:70996910-70996932 CCCAAACCTGAAGAATTATAAGG - Intergenic
1028582746 7:92424196-92424218 CCCAAGGGTTAAAAGATATATGG - Intergenic
1028671512 7:93406216-93406238 CCCATGTCTTTAGAGAAATACGG - Intergenic
1030386311 7:108871711-108871733 ACCAAGGCCCAAGAGATATAAGG + Intergenic
1030956744 7:115862295-115862317 CACAAGTCAGAGGAGATATAGGG + Intergenic
1031642490 7:124181399-124181421 CCCATGTATGAAGTGATAGAGGG - Intergenic
1033806901 7:144964520-144964542 CCCACGTCTGAACAGAGATGGGG - Intergenic
1034191237 7:149214964-149214986 CCCAAGTCTGGTGAGACATTTGG - Intronic
1036767896 8:11560499-11560521 CGCATGTCTGAAGAGGTAAATGG + Intronic
1037439592 8:18902086-18902108 CCCAAGTTTGGGGAGAGATATGG - Intronic
1038652627 8:29419464-29419486 CCCAATTTTTAAGAGATATGTGG + Intergenic
1040715808 8:50250421-50250443 CCCAAGTCTTAGGGGAGATATGG + Intronic
1041484577 8:58360353-58360375 CCCAAATCTTGAGAGAAATATGG + Intergenic
1044119338 8:88375571-88375593 CCCAAGTATTAAGAGAGAGATGG + Intergenic
1045852885 8:106724141-106724163 CTCAAATAGGAAGAGATATAAGG + Intronic
1046426942 8:114066086-114066108 CCCTAGACTGGAGAGATAAATGG + Intergenic
1048727099 8:137398790-137398812 CCCATGATTGAAGAGATAGATGG - Intergenic
1051260074 9:15255190-15255212 CCTAAAACTGAAGAGATATTTGG - Intronic
1053324086 9:37126750-37126772 CCTAAATCTGAAGAGAGATCAGG + Exonic
1055821284 9:80267516-80267538 TCCTAGTCTGAAGAGACAAAGGG - Intergenic
1056809823 9:89755658-89755680 CCAAATTCTATAGAGATATAGGG + Intergenic
1060062261 9:120471361-120471383 CCCAAGACTGCACACATATATGG - Intronic
1062727710 9:138085489-138085511 CCCAAGTCTGGGGAGAGATGTGG + Intronic
1188791841 X:34414649-34414671 TGCAACTCTGAAGAAATATAGGG + Intergenic
1190567791 X:51748491-51748513 GACAAGTCTGAGGAGATTTAAGG + Intergenic
1191641995 X:63436231-63436253 CCCAAGTCTGAGGAAGTACATGG - Intergenic
1191818290 X:65273558-65273580 CCCAAGTCTGGAGAAACAAATGG + Intergenic
1193390104 X:80915717-80915739 CTTAAGTCTCAAGAGAGATATGG + Intergenic
1193888344 X:87010653-87010675 CCCAAGTCTTGGGAGACATAGGG + Intergenic
1193903057 X:87206594-87206616 CCCAAATTTGAAGACAGATATGG + Intergenic
1193919421 X:87407093-87407115 CCCAAGCCTGCAGAGACATGGGG + Intergenic
1195661177 X:107380109-107380131 CCCAAGTGTGAGGAGATCTCAGG + Intergenic
1196539679 X:116892802-116892824 TCCAAATCTGAGGAGTTATATGG - Intergenic
1197098549 X:122624162-122624184 CCCAAGTCTGGAGAGATATCAGG + Intergenic
1199160313 X:144601844-144601866 ACCAAGTATTAAGAGATAAAGGG - Intergenic
1199528760 X:148823571-148823593 AGCAAATCTGAAGAGATATCTGG - Intronic