ID: 1110589158

View in Genome Browser
Species Human (GRCh38)
Location 13:77234401-77234423
Sequence AAATTTTATTAGAGGGCAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 1, 2: 2, 3: 24, 4: 239}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110589158_1110589164 29 Left 1110589158 13:77234401-77234423 CCTACTGCCCTCTAATAAAATTT 0: 1
1: 1
2: 2
3: 24
4: 239
Right 1110589164 13:77234453-77234475 CCTTCATTAAATGTACAAGTGGG 0: 1
1: 0
2: 1
3: 11
4: 170
1110589158_1110589162 28 Left 1110589158 13:77234401-77234423 CCTACTGCCCTCTAATAAAATTT 0: 1
1: 1
2: 2
3: 24
4: 239
Right 1110589162 13:77234452-77234474 CCCTTCATTAAATGTACAAGTGG 0: 1
1: 0
2: 0
3: 8
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110589158 Original CRISPR AAATTTTATTAGAGGGCAGT AGG (reversed) Intronic
902996276 1:20227921-20227943 AAATACATTTAGAGGGCAGTGGG + Intergenic
909800375 1:79799188-79799210 AAATATTATTAGAGTGTACTGGG + Intergenic
910702855 1:90094825-90094847 AAATTATATAAGAGGGAATTTGG - Intergenic
911908644 1:103602309-103602331 AATTTTTATTAAAGGGGAGTTGG - Intergenic
911914273 1:103677151-103677173 AATTTTTATTAAAGGGGAGTTGG + Intronic
914704185 1:150158119-150158141 AAATTTTATTATAAGGCAAGGGG + Intronic
917499159 1:175570322-175570344 AAATGGTAATTGAGGGCAGTTGG + Intronic
917787896 1:178479009-178479031 AAATCTTATTACATGGAAGTTGG - Intergenic
918417853 1:184330837-184330859 AAAATTTATTAGAGAGTAGAAGG + Intergenic
919195653 1:194281842-194281864 AAATTACAATAGAGGGTAGTGGG - Intergenic
919448294 1:197737934-197737956 AAATTTTATTAGAAAGGAGAGGG + Intronic
919512789 1:198487637-198487659 AAATTTTATTACAGAGCATGAGG - Intergenic
920802682 1:209204199-209204221 ATATTTTATTATAGGGCTGGAGG + Intergenic
924720303 1:246616381-246616403 AAATTTTCTGGGGGGGCAGTGGG - Intronic
1063755638 10:9004427-9004449 AAGTTTTATTAGAGGTGTGTAGG - Intergenic
1063898017 10:10702574-10702596 AAATTTTATTAGAACTCAGGTGG + Intergenic
1068220567 10:54039958-54039980 AGATTCTATGTGAGGGCAGTGGG + Intronic
1068726693 10:60311172-60311194 AAACCATATTAGAGGGCTGTTGG + Intronic
1070055699 10:72932583-72932605 AGATGTTCTTAGAGGGCGGTGGG - Exonic
1073661898 10:105485183-105485205 TAGTCTTATTAAAGGGCAGTGGG + Intergenic
1075178817 10:120191194-120191216 AAATTTTTTTACTGAGCAGTAGG + Intergenic
1075935756 10:126339810-126339832 AAATTTTATTTGAGTGAAGTGGG + Intronic
1076946899 10:133657721-133657743 AAATTTTATTAGAAGAAAGAGGG - Intergenic
1078062592 11:8057670-8057692 AAGTTTTATTGGAGGGCTGAAGG - Intronic
1078531485 11:12139845-12139867 AAAATTCATTTGAGGGCAATAGG - Intronic
1078612440 11:12832620-12832642 AAATTTTAATAGAGTGCAAAAGG - Intronic
1078650495 11:13186340-13186362 AAAATTTATTAGAGGATAGGAGG + Intergenic
1079288515 11:19163682-19163704 AAATGTTATTACAAGGAAGTAGG - Intronic
1079547433 11:21650131-21650153 AAATTTTATTGGACAGCATTGGG - Intergenic
1079878576 11:25893076-25893098 AAATTTTATTAGAGAGAAAATGG + Intergenic
1080127174 11:28749670-28749692 AAATTTCAATAGAATGCAGTGGG + Intergenic
1081735674 11:45401816-45401838 TATTATTATTAGAGTGCAGTGGG + Intergenic
1082057155 11:47827782-47827804 AAATTTTTTTGGAGGGAGGTGGG - Intronic
1082848627 11:57745756-57745778 GAGTTTGATTAGTGGGCAGTGGG + Exonic
1087564587 11:99837919-99837941 ATATTTTATTAGAGGGACTTAGG + Intronic
1088149616 11:106727977-106727999 AGATATTATTAGTGGGAAGTTGG - Intronic
1089451732 11:118603179-118603201 TAATTTTGTCAGACGGCAGTTGG + Intergenic
1090516814 11:127437504-127437526 AAAATTTATTACATAGCAGTAGG + Intergenic
1091098612 11:132848110-132848132 AAACTTTTTAAGATGGCAGTAGG + Intronic
1091180965 11:133604329-133604351 AAATTTTATAATAGGGCAAGAGG + Intergenic
1091606956 12:1961226-1961248 AAATATTTGTAGAGGGTAGTAGG + Intronic
1092816887 12:12320160-12320182 AAATTTTAGTAGAGGACATATGG + Intergenic
1093518689 12:20022086-20022108 ATACTTTATTAGGGAGCAGTGGG + Intergenic
1094204922 12:27829915-27829937 AGATGTTATTAGTGGGCATTGGG + Intergenic
1095088995 12:38086849-38086871 AAATTTTATTAGAAGAAAGGGGG + Intergenic
1096670771 12:53197110-53197132 AAATTTGAATAGAGGAGAGTTGG + Intronic
1099455334 12:82856322-82856344 GAAGTTTATTAGAATGCAGTAGG + Intronic
1099824369 12:87756119-87756141 AAATTTTACTAAATAGCAGTTGG + Intergenic
1099828231 12:87806740-87806762 AAATTTTATTAGACACAAGTAGG + Intergenic
1099937228 12:89141188-89141210 ATACTTTAATAGAGTGCAGTGGG - Intergenic
1100071435 12:90724316-90724338 ATATTTTGTTAGAGGGGAGGAGG - Intergenic
1102504795 12:113377054-113377076 GAATTTTATTAGATGCCAGCTGG - Intronic
1102800940 12:115733185-115733207 AATTATTCTTAGAAGGCAGTGGG - Intergenic
1103471009 12:121181071-121181093 TACTTTTAAGAGAGGGCAGTTGG - Intronic
1104119839 12:125788812-125788834 ATATTTTAAAAGATGGCAGTGGG + Intergenic
1104264551 12:127219490-127219512 AAAGTTTGTTGGAGGGCAGAGGG - Intergenic
1106467840 13:30028616-30028638 AGATTTTATTTTAGAGCAGTTGG - Intergenic
1107669623 13:42731364-42731386 AATTTTTCTTAGAGAGGAGTAGG - Intergenic
1108983822 13:56557243-56557265 AGATTTTCTCAGAGGGTAGTGGG + Intergenic
1109770865 13:66970743-66970765 TAACATTTTTAGAGGGCAGTAGG + Intronic
1110247673 13:73344625-73344647 AAATTTTATCAGAGAGCAGAGGG - Intergenic
1110581225 13:77130564-77130586 ACTTTTAATTAGGGGGCAGTTGG - Intronic
1110589158 13:77234401-77234423 AAATTTTATTAGAGGGCAGTAGG - Intronic
1110632032 13:77720176-77720198 AAATTTAAAAAAAGGGCAGTTGG + Intronic
1111006479 13:82256344-82256366 TAATTTTATTCAAGAGCAGTGGG - Intergenic
1111478654 13:88790677-88790699 AAATTTTATGAGAAGGCGGCAGG + Intergenic
1111794638 13:92902479-92902501 AAATTTTGGTAGAGCTCAGTGGG + Intergenic
1112674989 13:101690913-101690935 ATATTTTATTAGAAGGCTTTAGG + Intronic
1113158575 13:107353216-107353238 CAATTTTATTAGTGTGCAGGAGG - Intronic
1113598519 13:111551477-111551499 CAATTTAATTAGAGGGCAGTGGG + Intergenic
1115999749 14:39230034-39230056 AAATTTAATTAGAAGGTATTGGG - Intergenic
1117666740 14:58063507-58063529 ACATTTTATTAAAGATCAGTAGG + Intronic
1118941811 14:70346031-70346053 AAGCTTTAGGAGAGGGCAGTGGG - Intronic
1120702102 14:87709393-87709415 AACTTTTAATAGAGGGAATTAGG + Intergenic
1120990112 14:90368039-90368061 AAATTGTATTAGTGGGAAGGAGG + Intergenic
1121576681 14:94994650-94994672 CATTTCCATTAGAGGGCAGTAGG + Intergenic
1122217869 14:100215689-100215711 ACATTTTATCAGGGGACAGTGGG + Intergenic
1122737759 14:103853483-103853505 AAATTTTTGTAGAGGCCAGGCGG - Intergenic
1202920973 14_KI270723v1_random:30277-30299 AAATTTTATTAGAAGAAAGAGGG - Intergenic
1202923944 14_KI270724v1_random:7304-7326 AAATTTTATTAGAAGAAAGAGGG + Intergenic
1123963830 15:25436538-25436560 AAATTTTTTTGGAGGGGAGAGGG + Intronic
1125358941 15:38845864-38845886 AAATTGTATTAGTGGGAAGGAGG + Intergenic
1127048541 15:55054609-55054631 TAATGATTTTAGAGGGCAGTTGG - Intergenic
1127675102 15:61230576-61230598 TAATATTATTAGAGGCCAGAAGG + Intergenic
1128393524 15:67199737-67199759 AAATCTTATTAGAGGACTATAGG - Intergenic
1130657251 15:85800320-85800342 AAATTTTATTTGGGGGGAGTGGG + Intergenic
1133475048 16:6112852-6112874 AAATCTTTGTAGAGGGGAGTTGG + Intronic
1139729678 16:68932397-68932419 AAATTTAATTAAAGGGGAGAGGG + Intronic
1140290674 16:73652473-73652495 AAATTTTTTGAGAAGGCAGAAGG + Intergenic
1142962447 17:3559200-3559222 AACTTTTCTCAGAGGGCAGGTGG + Intergenic
1143089676 17:4442064-4442086 AAATTTCATGAAAGGACAGTGGG + Intronic
1143467812 17:7149627-7149649 AAATTGTATTACAAGGCATTGGG - Intergenic
1146018548 17:29253678-29253700 AAACTTTATTGGACGCCAGTGGG + Exonic
1146351607 17:32100164-32100186 AAATGTTAATATAGGGCAATTGG + Intergenic
1146831618 17:36074456-36074478 AAGTTTTATTGGAATGCAGTTGG + Intergenic
1148750516 17:49943077-49943099 ACTTTATCTTAGAGGGCAGTAGG + Intergenic
1149407197 17:56365281-56365303 AAATTTTATTTGAGGCAAGAGGG + Intronic
1149962274 17:61123618-61123640 AATTTTTATTGGGGGGGAGTGGG + Intronic
1150367805 17:64606016-64606038 AAGTTTTATGAGAGGGGATTGGG - Intronic
1150456669 17:65311878-65311900 AGACTTTCTGAGAGGGCAGTCGG - Intergenic
1150900225 17:69266684-69266706 AAATTTTATTATTGTGCAGTGGG + Intronic
1151117482 17:71754043-71754065 AAATTTTCTTTTAAGGCAGTAGG - Intergenic
1153968851 18:10206287-10206309 AAATTTTAATATAGGGTATTAGG + Intergenic
1154091367 18:11366811-11366833 ACATTTTATTTGAAAGCAGTTGG + Intergenic
1154347469 18:13554633-13554655 AAATATTATTAAAGGGCAATAGG - Intronic
1156731345 18:40196943-40196965 AAATTTTAATTGAGTGCACTTGG - Intergenic
1156831771 18:41500341-41500363 AAATTTTATTAGAAGGCAAGGGG + Intergenic
1157436343 18:47672668-47672690 TAATTTGACTAGAGGGCAGCAGG + Intergenic
1159244570 18:65789149-65789171 GAATTTTATTAATGTGCAGTGGG + Intronic
1161206303 19:3042836-3042858 AAATTTTTTTTAACGGCAGTGGG + Intronic
1162853670 19:13451489-13451511 AACTTTTATTAGATTCCAGTAGG - Intronic
1164055551 19:21619218-21619240 AAATTTTATAAGATGGTACTTGG + Intergenic
1164876029 19:31690152-31690174 AAATTTTATTAGATGTCTTTTGG + Intergenic
1166865965 19:45837692-45837714 AAATTTTACTTGAAGGAAGTTGG + Intronic
1202657368 1_KI270708v1_random:36409-36431 AAATTTCAATAGAGGCCAATTGG - Intergenic
929189115 2:39123305-39123327 ACATTTTATTTGGGGGCAGGAGG - Intronic
930141706 2:47957214-47957236 AAATGTTATTATTGGGCAATGGG + Intergenic
930807185 2:55502851-55502873 AAATTTGACTAGAAGCCAGTCGG - Intergenic
932695677 2:73954168-73954190 AATTTTTTGTAGAGGGCAGGGGG - Intronic
933327713 2:80859906-80859928 AAATTTTTTTAAAGGTTAGTAGG - Intergenic
935001332 2:99019058-99019080 AAATTTCATTATAAGGCACTTGG - Intronic
938761171 2:134427489-134427511 CGATTTTATTTGAGGGGAGTAGG - Intronic
938797366 2:134729454-134729476 ATATTTTATCAGAGAGAAGTGGG + Intergenic
938803014 2:134780212-134780234 AAATTTTATGAGAGAGCTGAGGG - Intergenic
939825384 2:147009285-147009307 ACAGTTTATTAGCGGACAGTTGG + Intergenic
940276576 2:151946504-151946526 AAATGTTATCAGAAGGCTGTTGG + Intronic
941355459 2:164485858-164485880 AAATATTTTTAGACTGCAGTTGG + Intergenic
943123116 2:183762412-183762434 ACATTTTATTTGCAGGCAGTAGG - Intergenic
943182970 2:184567327-184567349 AAAGTTTTCTAGAAGGCAGTAGG - Intergenic
945192168 2:207200197-207200219 GAATTCTATTAGAGGTCCGTGGG - Intergenic
945753434 2:213816972-213816994 AAATTTTATTACATTGCTGTAGG - Intronic
946568383 2:220993679-220993701 TAACTTTCTTAGAGGGCTGTGGG - Intergenic
947677779 2:231999777-231999799 ACAATATATTAGAGGGCAGCAGG - Intronic
1169110518 20:3030123-3030145 ACATTTTATCACAGGGCAGTGGG - Intronic
1170198677 20:13717817-13717839 ACTTTTTATTTGAGGGTAGTTGG - Intronic
1170307579 20:14956778-14956800 ACATTTAATTAGGGGGCAGTTGG + Intronic
1170856238 20:20058191-20058213 CAATTTTACTAGAGGGCAGTAGG + Intronic
1173406485 20:42770794-42770816 AAAGTTTGTTAGAGGGTAGTTGG + Intronic
1174331856 20:49826191-49826213 AAATTATGTTAGAGGACATTTGG + Intronic
1174732866 20:52935168-52935190 AAATTTTCTTAGTGAGAAGTTGG + Intergenic
1174985537 20:55447756-55447778 AAATTTTATTTAAGGGCTGTTGG - Intergenic
1175060134 20:56234344-56234366 AAATTTTATTGGAGGATAGATGG + Intergenic
1176597239 21:8758753-8758775 AAATTTCAATAGAGGCCAATTGG - Intergenic
1176643056 21:9324715-9324737 AAATTTCAATAGAGGCCAATTGG - Intergenic
1177340040 21:19786375-19786397 AAATTATACTAGAGGTCAATGGG + Intergenic
1179993548 21:44961211-44961233 AAATTTTATTCCATGGCACTTGG + Intronic
1180369878 22:11974501-11974523 AAATTTCAATAGAGGCCAATTGG + Intergenic
1180376366 22:12097604-12097626 AAATTTCAATAGAGGCCAATTGG - Intergenic
1180421207 22:12816081-12816103 AAATTTCAATAGAGGCCAATTGG + Intergenic
1180662976 22:17485155-17485177 ACTTTCTATTAGAGGGCTGTCGG - Intronic
1181974111 22:26716429-26716451 AAATTTTAATAGATGGCATGGGG - Intergenic
1184268996 22:43366847-43366869 ATATTTTTTAAAAGGGCAGTGGG - Intergenic
953356563 3:42261118-42261140 CAATTCTATTGGAGGGCAGTGGG - Intronic
955041193 3:55319249-55319271 AAATTTTATTAGAAGGCTACTGG - Intergenic
956389089 3:68752633-68752655 GAGTTATATTATAGGGCAGTTGG - Intronic
957080560 3:75632695-75632717 AAATTTTATTAGAAGAAAGAGGG + Intergenic
957097027 3:75785868-75785890 AAATTTCAATAGAGGCCAATTGG + Intergenic
958097271 3:88962996-88963018 GCATTTTATTAGAGAGCTGTTGG + Intergenic
962055562 3:131867654-131867676 AATTTTTATTTGAGGGAGGTAGG + Intronic
962356137 3:134695719-134695741 GAAACTGATTAGAGGGCAGTGGG + Intronic
963445487 3:145401181-145401203 AAATTTTAGAAGAGGACTGTTGG + Intergenic
963690633 3:148496963-148496985 ACATTTTATTAGAGGACAAAGGG - Intergenic
966167070 3:177031633-177031655 AAATTTTATTAGAAGGCTCATGG + Intronic
968352063 3:198066106-198066128 AAGTTTTATGAGAGTACAGTTGG + Intergenic
1202743829 3_GL000221v1_random:80314-80336 AAATTTCAATAGAGGCCAATTGG + Intergenic
970361649 4:15314984-15315006 AAATTTTTTTCAAGGGCAGTTGG - Intergenic
970534736 4:17019304-17019326 GGATTTTATTAGAATGCAGTAGG + Intergenic
972728971 4:41774275-41774297 AAAATATATAAGAGGGCAGGAGG - Intergenic
973360533 4:49160972-49160994 AAATTTCAATAGAGGCCAATTGG - Intergenic
973399552 4:49626943-49626965 AAATTTCAATAGAGGCCAATTGG + Intergenic
974340247 4:60605060-60605082 ACATTTTGTTGGAGGGCATTGGG - Intergenic
974433323 4:61826756-61826778 AAATTTTATTACAGGGTTGGGGG + Intronic
979174370 4:117644179-117644201 AAATTTGATTTGAGGACAATTGG + Intergenic
980606929 4:135104422-135104444 CAATTTTTTTAGATGGCAGTAGG - Intergenic
983797948 4:171889098-171889120 AAATTTTAATAGATGTCAGTAGG + Intronic
984689480 4:182708947-182708969 ACATTTTACTAGAAAGCAGTGGG + Intronic
985450356 4:190058520-190058542 AAATTTTATTAGAAGAAAGAGGG - Intergenic
1202757965 4_GL000008v2_random:83037-83059 AAATTTCAATAGAGGCCAATTGG - Intergenic
990206071 5:53430829-53430851 GAATTCCACTAGAGGGCAGTTGG - Intergenic
991056075 5:62322085-62322107 AATTTTTTTTAGAGGGGATTGGG + Intronic
993080775 5:83296615-83296637 ATATTTTATTAGATGGAAGGAGG + Intronic
993131133 5:83899716-83899738 AAATATTATTATTTGGCAGTGGG + Intergenic
993533738 5:89055255-89055277 AAATTTTATCAGTGGTCAGCGGG - Intergenic
994309659 5:98253962-98253984 AAATTTTTTTAAAAAGCAGTGGG - Intergenic
994898062 5:105731029-105731051 AGATTTTATTAGAGCAAAGTAGG + Intergenic
995632722 5:114151300-114151322 AAACTTGATTAAATGGCAGTGGG + Intergenic
997293499 5:132754710-132754732 AAAGAATATTAGAGGGAAGTAGG - Intronic
1003161004 6:3634123-3634145 ATTTTTAGTTAGAGGGCAGTTGG - Intergenic
1003594324 6:7460964-7460986 AAATCTTGTTAGAGGTTAGTTGG + Intergenic
1003759954 6:9168281-9168303 AATCTTTTTTGGAGGGCAGTGGG + Intergenic
1004114354 6:12751174-12751196 AAATTATATTCCAAGGCAGTTGG - Intronic
1004199851 6:13537710-13537732 AAATTTTATTAGATTGCTTTGGG - Intergenic
1006629603 6:35421681-35421703 AAATTTTTTTGGAGGGGAGATGG - Intronic
1007563352 6:42829037-42829059 AAATCATATTAAAGGGCAGCGGG + Exonic
1008060450 6:46991145-46991167 GCATTTTATAAGAAGGCAGTAGG - Intergenic
1008232320 6:48997422-48997444 AAATTTTTTTTGAGGGAACTAGG + Intergenic
1008826966 6:55707534-55707556 AAATTATATTAGAAGACAGTAGG + Intergenic
1011115737 6:83889545-83889567 AAACTTTTTTAAAGAGCAGTAGG - Intronic
1012685903 6:102248145-102248167 AAATATTAATAGAGCTCAGTAGG + Intergenic
1012947601 6:105484457-105484479 AAATTAGATGAGAAGGCAGTTGG - Intergenic
1013384755 6:109615274-109615296 ACATTTTAATAGAAGGCAGAAGG - Intronic
1018601468 6:165548102-165548124 AAATTATATGAGAGGAGAGTAGG - Intronic
1019405015 7:878496-878518 ATATTGTATTTAAGGGCAGTTGG + Intronic
1022616351 7:31934746-31934768 AAATTTTACTCAAGGTCAGTTGG + Intronic
1022810599 7:33864263-33864285 AACTTTTTTTAGAGGGCTATGGG - Intergenic
1023427877 7:40058292-40058314 AAATTTTATTTGATTGCAGTGGG + Intronic
1023487291 7:40700755-40700777 GTATTTTGTTAGAGGCCAGTAGG + Intronic
1025788892 7:64669320-64669342 AAATTTTATGAGATGAAAGTTGG + Intronic
1025825015 7:65003788-65003810 AAATTTTATGAGAGGAAACTTGG - Intronic
1025854491 7:65265556-65265578 AGATTTTATTAGAAGGAAGAGGG + Intergenic
1027873512 7:83740588-83740610 ATATTATATAAAAGGGCAGTTGG + Intergenic
1028330247 7:89581378-89581400 AAATTTTATTAGAAAGGAGGAGG - Intergenic
1028482741 7:91325493-91325515 AAATCATATTAGAGGGAAGAGGG - Intergenic
1028738633 7:94247223-94247245 AAATTTTATTAGAGAAGATTTGG + Intergenic
1029012304 7:97274493-97274515 TATTTTTAGTAGAGGGCAGTGGG + Intergenic
1029877405 7:103769062-103769084 AAATTTTATTCAAGGTCAGTTGG - Intronic
1031357594 7:120806342-120806364 ACATTTTAATAAAGGGAAGTGGG - Intronic
1031683389 7:124702639-124702661 AAATTTAATTTGAGAGCTGTGGG - Intergenic
1031780499 7:125956361-125956383 AAATTTGATAAGAGCTCAGTTGG + Intergenic
1032271561 7:130412835-130412857 AATTTTTATTGGAGTGAAGTTGG - Intronic
1032885098 7:136128988-136129010 CAATTTTATTAGCCTGCAGTTGG + Intergenic
1033178235 7:139147503-139147525 AAATTTCATGGGAGGGCAATTGG - Intronic
1033647597 7:143317215-143317237 GAATTTGTCTAGAGGGCAGTTGG + Intronic
1036961974 8:13254433-13254455 AAAATTTATTAGAATGCAGATGG + Intronic
1037900665 8:22686610-22686632 AGTTTTTTTTAGAGGGCAGGCGG + Intergenic
1038630415 8:29237938-29237960 TAATTTTATTAGAGTACAGTGGG - Intronic
1042272074 8:66964560-66964582 AAATAATATTAGAGGGAAGGTGG + Intronic
1042337320 8:67642019-67642041 AAATTTGATTAAAGGACATTAGG + Intronic
1042695478 8:71549550-71549572 AAATTTTATTTGAGGGAGGAGGG + Intronic
1043160208 8:76837548-76837570 ACATTTTATTAAAGGGAAATAGG + Intronic
1043363641 8:79504751-79504773 ACTTTTTATTTGAAGGCAGTAGG - Intergenic
1045987439 8:108264972-108264994 AAATTTTATTATACAGCAATAGG + Intronic
1047570358 8:126091476-126091498 AAAAGTTATTTGAGGGCAGTTGG + Intergenic
1047749320 8:127867836-127867858 TGATTTTATTAGGGGGCAGAGGG - Intergenic
1050318097 9:4423660-4423682 AATATTTATTATAGGGCATTGGG - Intergenic
1051627862 9:19115196-19115218 AAATTTTACTAGGTGACAGTTGG - Intronic
1052284450 9:26769039-26769061 AGATTTTTTTAAAGGGAAGTAGG + Intergenic
1052994785 9:34546186-34546208 TCATTTTATTAGAGGGAGGTGGG + Intergenic
1058066301 9:100552173-100552195 AGACTTTATTTGTGGGCAGTGGG + Intronic
1058091101 9:100806379-100806401 AAAGTTCTTTACAGGGCAGTAGG + Intergenic
1059497075 9:114718812-114718834 GAAATTTATTAGAAGGCAGGGGG - Intergenic
1059505115 9:114791556-114791578 AAATTTTCTTATAGGTCAGGAGG + Intronic
1060955733 9:127637960-127637982 AAATTGTATTTGTGGGAAGTGGG - Intronic
1203689570 Un_GL000214v1:30057-30079 AAATTTCAATAGAGGCCAATTGG - Intergenic
1203712461 Un_KI270742v1:110278-110300 AAATTTCAATAGAGGCCAATTGG + Intergenic
1203538755 Un_KI270743v1:67909-67931 AAATTTCAATAGAGGCCAATTGG - Intergenic
1203556060 Un_KI270743v1:208604-208626 AAATTTCAATAGAGGCCAATTGG + Intergenic
1203646705 Un_KI270751v1:73996-74018 AAATTTCAATAGAGGCCAATTGG + Intergenic
1186425513 X:9462287-9462309 AATTTTAATTAAAAGGCAGTAGG - Intergenic
1186748637 X:12597789-12597811 AAATTTTACTATAGGTCTGTTGG + Intronic
1186791028 X:12998900-12998922 AAATTTTTTTAGAGGGCAGTAGG + Intergenic
1189127446 X:38463169-38463191 AAATTTTATTGGAATACAGTGGG - Intronic
1189864392 X:45310410-45310432 AAATATTATTAGAGGGCAACTGG - Intergenic
1190105653 X:47559360-47559382 AAATTATATGGGAGGCCAGTAGG + Intergenic
1190895864 X:54617391-54617413 CAATTATAGTAGAGGGCAGAGGG - Intergenic
1191670883 X:63747442-63747464 AAATTTTATTCTAGGACTGTGGG - Intronic
1193017133 X:76747854-76747876 AAATATTATTACAGAGCAGTTGG + Intergenic
1193716502 X:84940425-84940447 AAATCTTATTTGAGGATAGTAGG + Intergenic
1194528205 X:95006916-95006938 ATATTTTATTATAGAGCAGCTGG + Intergenic
1195659324 X:107362629-107362651 AAATTTTAAGAGAGGGAAGCGGG - Intergenic
1198330156 X:135615391-135615413 AACTTTTCTGAGATGGCAGTAGG - Intergenic
1198336773 X:135673609-135673631 AACTTTTCTGAGATGGCAGTGGG + Intergenic
1198362820 X:135912854-135912876 AACTTTTCTGAGATGGCAGTGGG - Exonic
1199529410 X:148830178-148830200 AAATTCCCTTAGAGGGAAGTAGG - Intronic
1199680591 X:150221823-150221845 AAACTGTAGTAGAGGGAAGTGGG - Intergenic
1202305074 Y:23460553-23460575 AAATTTCAAAAGATGGCAGTGGG + Intergenic
1202565735 Y:26210036-26210058 AAATTTCAAAAGATGGCAGTGGG - Intergenic