ID: 1110592525

View in Genome Browser
Species Human (GRCh38)
Location 13:77280780-77280802
Sequence CATTGTGACCAAAGTTTTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 326}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110592525_1110592529 4 Left 1110592525 13:77280780-77280802 CCCATAAAACTTTGGTCACAATG 0: 1
1: 0
2: 3
3: 25
4: 326
Right 1110592529 13:77280807-77280829 TAGGGAACTCTTCATCTGTCTGG 0: 1
1: 0
2: 1
3: 9
4: 105
1110592525_1110592530 5 Left 1110592525 13:77280780-77280802 CCCATAAAACTTTGGTCACAATG 0: 1
1: 0
2: 3
3: 25
4: 326
Right 1110592530 13:77280808-77280830 AGGGAACTCTTCATCTGTCTGGG 0: 1
1: 0
2: 1
3: 13
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110592525 Original CRISPR CATTGTGACCAAAGTTTTAT GGG (reversed) Intronic
900790094 1:4674287-4674309 CTTTGTAAATAAAGTTTTATTGG + Intronic
900790099 1:4674333-4674355 CTTTGTAAACAAAGTTTTATTGG + Intronic
901108403 1:6775823-6775845 TTTTGTGAATAAAGTTTTATTGG + Intergenic
901344166 1:8524194-8524216 CATTGTGACCATATTTATTTGGG - Intronic
902190683 1:14760973-14760995 CTTTATGAATAAAGTTTTATTGG - Intronic
905497214 1:38401717-38401739 TTTTGTGAATAAAGTTTTATTGG + Intergenic
907408140 1:54266374-54266396 CAATGTAAATAAAGTTTTATTGG + Intronic
907537891 1:55181904-55181926 CATTAAGACACAAGTTTTATTGG - Intronic
908160711 1:61405708-61405730 CATTTTGATCAGAATTTTATAGG + Intronic
908615849 1:65921683-65921705 TTTTGTAAACAAAGTTTTATTGG - Intronic
909107682 1:71432979-71433001 CATTGGAGACAAAGTTTTATGGG - Intronic
909299011 1:73987289-73987311 CTTTCTGAGCAAAGTTTTAAAGG - Intergenic
909343995 1:74564257-74564279 CTTTGTAAATAAAGTTTTATTGG + Intergenic
911816160 1:102354504-102354526 CTTTGTGCCCAAAATTTGATTGG - Intergenic
912268472 1:108184644-108184666 CTTTGTAAATAAAGTTTTATTGG + Intronic
915249368 1:154577499-154577521 CATTGCCACCTACGTTTTATAGG - Exonic
916520181 1:165556624-165556646 TTTTGTAAACAAAGTTTTATTGG - Intronic
916624807 1:166543719-166543741 AATTGTGACCATAAATTTATTGG - Intergenic
916874277 1:168952434-168952456 CATTCTGAATAAAGTTTCATTGG + Intergenic
917100293 1:171438391-171438413 CATTGTCCATAAAGTTTTATTGG - Intergenic
917337327 1:173939072-173939094 TTTTGTAACTAAAGTTTTATTGG + Intronic
917600004 1:176564443-176564465 TTTTGTGAATAAAGTTTTATTGG - Intronic
918532472 1:185538596-185538618 CAGTCTGACCAAAGTTTATTAGG - Intergenic
918981037 1:191559497-191559519 TATTTTTATCAAAGTTTTATTGG + Intergenic
918993795 1:191731265-191731287 AATCTTGAACAAAGTTTTATGGG - Intergenic
920014087 1:202891981-202892003 CCTTGTCCCCAAAGTTTTGTGGG + Exonic
921745863 1:218740115-218740137 CATTTAAAACAAAGTTTTATAGG + Intergenic
922421551 1:225463927-225463949 TTTTGTGAATAAAGTTTTATTGG + Intergenic
922989198 1:229891441-229891463 TATTGTAAATAAAGTTTTATTGG + Intergenic
923091810 1:230746799-230746821 CTTTGTAAATAAAGTTTTATTGG + Intergenic
923555366 1:234996551-234996573 TTTTGTGAATAAAGTTTTATTGG + Intergenic
924926394 1:248687703-248687725 CAGTGTGAACAAGCTTTTATGGG + Intergenic
1063980760 10:11449894-11449916 CATTGAGACCTAAGTTTTGTTGG + Intergenic
1067020219 10:42790199-42790221 GTTTGTAACTAAAGTTTTATTGG - Intronic
1067499946 10:46794602-46794624 GTTTGTAACTAAAGTTTTATTGG - Intergenic
1067533302 10:47090227-47090249 CTTTGTCAATAAAGTTTTATTGG + Intergenic
1067594686 10:47545723-47545745 GTTTGTAACTAAAGTTTTATTGG + Intronic
1067641795 10:48053838-48053860 GTTTGTAACTAAAGTTTTATTGG + Intergenic
1068867278 10:61907762-61907784 TTTTGTGAATAAAGTTTTATTGG + Intronic
1069600674 10:69704755-69704777 CATTTTTACCCATGTTTTATTGG + Intergenic
1070139037 10:73722680-73722702 GTTTGTAACTAAAGTTTTATTGG + Intergenic
1073665123 10:105523087-105523109 CATTGTGACTGGAGTTTCATAGG + Intergenic
1073715312 10:106099836-106099858 AATTTTCACCAAAGTTCTATTGG + Intergenic
1074267189 10:111916170-111916192 TATTGGAACTAAAGTTTTATTGG + Intergenic
1075173518 10:120137978-120138000 GTTTGTGAATAAAGTTTTATTGG - Intergenic
1075191121 10:120309787-120309809 TTTTGTGAATAAAGTTTTATTGG - Intergenic
1076199844 10:128549396-128549418 CTTTGTAAATAAAGTTTTATTGG - Intergenic
1076986349 11:238691-238713 CATTGGGGCAAAAGTTTTTTTGG + Intronic
1078847721 11:15135620-15135642 CTATGTGACCAAAGTAGTATGGG - Intronic
1079374624 11:19880823-19880845 CATTAAGACAAAAGTTTTACAGG - Intronic
1083475921 11:62915451-62915473 CTTTGTAACTAAAGTTTTATTGG - Intronic
1084753400 11:71219310-71219332 TTTTGTGAATAAAGTTTTATTGG - Intronic
1085826599 11:79854322-79854344 CACAGTGACCTAAGTGTTATAGG + Intergenic
1086553801 11:88085679-88085701 CTTTGTAAACCAAGTTTTATTGG + Intergenic
1087337056 11:96857512-96857534 CAGTGGGAGCAAAGTTGTATTGG - Intergenic
1089131229 11:116213732-116213754 CATTGTAAATAAAGTTTTATTGG + Intergenic
1091576310 12:1739552-1739574 CAGTGTTAATAAAGTTTTATTGG + Intronic
1092493677 12:8970204-8970226 TTTTGTGAGTAAAGTTTTATTGG + Intronic
1097463262 12:59890156-59890178 TATTGTAAATAAAGTTTTATTGG + Intergenic
1097667634 12:62498401-62498423 AATTGTGGCCATAGTTTCATGGG + Intronic
1099212623 12:79811709-79811731 CATTGTCCCTAAAGTTTTATTGG - Intronic
1100864610 12:98843642-98843664 CAGTGTGACTACAGTTTAATCGG + Intronic
1101708065 12:107239520-107239542 TATAGTGACCAAAATTTTAGTGG + Intergenic
1101856890 12:108451178-108451200 TATTGTAAATAAAGTTTTATTGG + Intergenic
1102404632 12:112662747-112662769 TTTTGTAAGCAAAGTTTTATTGG - Intronic
1102568580 12:113813372-113813394 TTTTGTGAATAAAGTTTTATTGG - Intergenic
1102825415 12:115944313-115944335 TTTTGTGAATAAAGTTTTATTGG - Intergenic
1103925107 12:124419371-124419393 TCTTGTGAATAAAGTTTTATTGG - Intronic
1104071677 12:125351252-125351274 TTTTGTAACTAAAGTTTTATTGG - Intronic
1106368355 13:29106102-29106124 CATTGTGTCCAAACTGTTAAGGG - Intronic
1106916953 13:34526001-34526023 CTTTGTAATTAAAGTTTTATTGG - Intergenic
1107125178 13:36838807-36838829 CATTGTCCACAAAGTTTTATTGG + Intergenic
1107780086 13:43890942-43890964 TTTTGTAAACAAAGTTTTATTGG - Intronic
1109560033 13:64034593-64034615 CATTGTGGCCAGAGCTTCATAGG + Intergenic
1109703970 13:66064109-66064131 CTTTGTGACAAAAATTATATGGG + Intergenic
1110483214 13:76007388-76007410 CACTGTGACCTTAGATTTATTGG + Intergenic
1110592525 13:77280780-77280802 CATTGTGACCAAAGTTTTATGGG - Intronic
1110913560 13:80993501-80993523 CTTTCTAAACAAAGTTTTATTGG + Intergenic
1112313358 13:98339706-98339728 CTTTGGCACCAAATTTTTATAGG - Intronic
1112967474 13:105214410-105214432 CACTGTGACTAAAATTTTCTGGG + Intergenic
1114057277 14:18982491-18982513 CATTGTGAGTAAAGTTTTATAGG - Intronic
1114105269 14:19419255-19419277 CATTGTGAGTAAAGTTTTATAGG + Intronic
1114510461 14:23255457-23255479 CATTGATACCAACATTTTATTGG - Intronic
1121360139 14:93249595-93249617 CTTTGTAAATAAAGTTTTATTGG + Intronic
1121782925 14:96633937-96633959 TTTTGTAAGCAAAGTTTTATTGG + Intergenic
1122107429 14:99469058-99469080 CATTGTAACCATATTTTTAATGG - Intronic
1122595884 14:102891715-102891737 TTTTGTAAACAAAGTTTTATTGG + Intronic
1123498157 15:20851591-20851613 CTTTGTAAATAAAGTTTTATAGG + Intronic
1123555388 15:21425219-21425241 CTTTGTAAATAAAGTTTTATAGG + Intronic
1123591631 15:21862550-21862572 CTTTGTAAATAAAGTTTTATAGG + Intergenic
1126059340 15:44764641-44764663 CTTTGTAAGTAAAGTTTTATTGG - Intronic
1128372058 15:67047666-67047688 CATTGTTCCCAAAGGGTTATAGG + Intergenic
1129350244 15:74951862-74951884 TTTTGTGACCTAAGTTTTCTAGG + Intergenic
1130423370 15:83771097-83771119 CAATGTGACAAATGTTTTGTGGG - Intronic
1130827264 15:87562143-87562165 GATTGTGAGAAAAGTTTTATTGG - Intergenic
1202963732 15_KI270727v1_random:152429-152451 CTTTGTAAATAAAGTTTTATAGG + Intergenic
1133550248 16:6847489-6847511 CACTGTGGCCCACGTTTTATTGG + Intronic
1133584333 16:7177839-7177861 TTTTGTAACTAAAGTTTTATCGG - Intronic
1133906678 16:10028848-10028870 TTTTGTGAATAAAGTTTTATTGG - Intronic
1133974767 16:10592785-10592807 CTTTGTAAATAAAGTTTTATTGG - Intergenic
1134349077 16:13419795-13419817 CTTTGTAAATAAAGTTTTATTGG - Intergenic
1134630850 16:15755076-15755098 TATTGTAAATAAAGTTTTATTGG - Intronic
1134785532 16:16939161-16939183 TATTGTAAATAAAGTTTTATTGG - Intergenic
1134798287 16:17061518-17061540 CTTTGTAAATAAAGTTTTATTGG + Intergenic
1135104572 16:19637057-19637079 TTTTGTGAATAAAGTTTTATTGG + Intronic
1135192482 16:20366163-20366185 AAGTGTGATCAAGGTTTTATAGG - Intronic
1135740025 16:24967247-24967269 CATTGTAAATAAAGTTTTATTGG + Intronic
1136038379 16:27558617-27558639 TATTGTAAATAAAGTTTTATTGG + Intronic
1137346708 16:47668567-47668589 CATTCTGCCCAGAGTTTTTTTGG + Intronic
1137903666 16:52296865-52296887 TTTTGTAAACAAAGTTTTATTGG - Intergenic
1139122712 16:64040492-64040514 AATTGTGAGCAGAGTTTTATGGG - Intergenic
1139762288 16:69195106-69195128 CATTGAGATCATATTTTTATAGG + Intronic
1140234754 16:73148084-73148106 TATTGTAAATAAAGTTTTATTGG + Intergenic
1140325483 16:73997504-73997526 TTTTGTGAATAAAGTTTTATTGG - Intergenic
1141154973 16:81590925-81590947 CTTTGTAAATAAAGTTTTATTGG + Intronic
1143186118 17:5011488-5011510 CATTTTGAACAAAGAGTTATAGG + Intronic
1144641059 17:16936930-16936952 CATGGTGAATAAAGGTTTATTGG + Intronic
1145158460 17:20558180-20558202 TATTGTGAATAAAGGTTTATTGG + Intergenic
1148594975 17:48846567-48846589 CACTGTGACCAAAATATCATTGG - Intronic
1149836806 17:59920477-59920499 TACTGTGACCACAATTTTATTGG + Intronic
1150121082 17:62603246-62603268 CATTGTGTCCATGGTGTTATTGG - Intronic
1150452602 17:65281422-65281444 TTTTGTAAACAAAGTTTTATTGG - Intergenic
1150710283 17:67525414-67525436 CTTTGTAAATAAAGTTTTATTGG - Intronic
1153627943 18:7039677-7039699 TTTTGTGAATAAAGTTTTATTGG - Intronic
1153652138 18:7250215-7250237 CAGTGTAAATAAAGTTTTATTGG + Intergenic
1153720695 18:7898917-7898939 CATTGTGACCAAAGGCTCACAGG - Intronic
1154456159 18:14528015-14528037 CTTTGTAAATAAAGTTTTATAGG + Intronic
1155124284 18:22856098-22856120 CTATGTAATCAAAGTTTTATTGG - Intronic
1155905488 18:31446067-31446089 CTTTGTAAATAAAGTTTTATTGG - Intergenic
1156120798 18:33840765-33840787 TATTGTAAATAAAGTTTTATTGG - Intergenic
1156285248 18:35687204-35687226 CATTTTGCCTAAAGTGTTATTGG + Intronic
1158169111 18:54576441-54576463 GATTTTGACCTAAGTTTTATGGG + Intergenic
1158826456 18:61225572-61225594 TATTCTGACCAAAGGTTCATAGG + Intergenic
1159193108 18:65074143-65074165 CTTTGTAAATAAAGTTTTATTGG - Intergenic
1161332507 19:3695036-3695058 TCTTGTCAACAAAGTTTTATTGG - Intronic
1161585981 19:5105879-5105901 TTTTGTGAATAAAGTTTTATTGG - Intronic
1163649442 19:18508801-18508823 CTTTGTAAATAAAGTTTTATAGG - Intronic
1166265344 19:41679347-41679369 AATTTTGACAAATGTTTTATTGG - Intronic
1167105237 19:47426553-47426575 CAATGTGCCCAAAGTTTCACAGG - Intergenic
1167831617 19:52027620-52027642 CTTGGTGTCCAGAGTTTTATTGG - Intronic
1168519611 19:57038283-57038305 CTTTGTAAATAAAGTTTTATTGG - Intergenic
925110395 2:1330710-1330732 CATTGTGACCATTGTTTTTTAGG + Intronic
925363865 2:3297719-3297741 TTTTGTGAATAAAGTTTTATTGG - Intronic
926452477 2:13022650-13022672 ATTTGTGAATAAAGTTTTATAGG - Intergenic
926998250 2:18763017-18763039 CACTGTGACCAAAGATTAGTTGG - Intergenic
929612227 2:43279564-43279586 TTTTGTAAGCAAAGTTTTATTGG + Intronic
930301343 2:49619639-49619661 CATTCTGGCCAATGTGTTATAGG - Intergenic
930602525 2:53458435-53458457 CAGTGTCACCTAAGTTTTAATGG + Intergenic
931029648 2:58157885-58157907 TTTTGTGAATAAAGTTTTATTGG - Intronic
931034862 2:58228501-58228523 TTTTGTAAACAAAGTTTTATTGG + Intronic
932941971 2:76177539-76177561 CATTCTGACCAAAATTTATTAGG + Intergenic
936077246 2:109409429-109409451 TTTTGTGAATAAAGTTTTATTGG - Intronic
936385807 2:112027999-112028021 CTTTGTAAATAAAGTTTTATTGG - Intronic
936958142 2:118043988-118044010 CATTCTCACCATAGTTTTAATGG + Intergenic
938285020 2:130105539-130105561 CTTTGTAAATAAAGTTTTATAGG + Intronic
938475409 2:131606523-131606545 CTTTGTAAATAAAGTTTTATAGG - Intergenic
940283392 2:152010045-152010067 CATAGGGAGCTAAGTTTTATTGG + Intronic
940418244 2:153447870-153447892 CATTGTGATCAAATTTTAAATGG + Intergenic
940487257 2:154311642-154311664 CAGTCTGACCAAAGTTTATTAGG + Intronic
940563115 2:155326709-155326731 CATTATGAACAAAGTTTCACTGG + Intergenic
942282455 2:174379547-174379569 CCTTGTAAAGAAAGTTTTATTGG - Intronic
942993421 2:182231252-182231274 CACTTTGACCAGAGTTTCATAGG + Intronic
943336993 2:186627635-186627657 TTTTGTGAATAAAGTTTTATTGG + Intronic
943492728 2:188576305-188576327 CACAGTGACCAAAGTTATATTGG - Intronic
943526603 2:189024245-189024267 AATTATGAGCAAATTTTTATAGG + Intergenic
943996804 2:194778297-194778319 CATTATGGCCAAAGCTTTGTAGG + Intergenic
944524318 2:200602681-200602703 CATTGTGACCAAAGCTGTGACGG - Intronic
945371821 2:209027969-209027991 TATTGTGACCAGAGGCTTATAGG - Intergenic
946610748 2:221455189-221455211 AATTGGGGCCCAAGTTTTATAGG + Intronic
947304242 2:228725802-228725824 AATTCAGAACAAAGTTTTATAGG + Intergenic
948667870 2:239547351-239547373 TATTGTCAATAAAGTTTTATTGG - Intergenic
1169595483 20:7193703-7193725 CTTTGAAACCAAAGCTTTATAGG + Intergenic
1170092954 20:12612553-12612575 CCTTGTAAATAAAGTTTTATCGG + Intergenic
1170285917 20:14708394-14708416 TTTTGTAAACAAAGTTTTATTGG - Intronic
1170377108 20:15712287-15712309 TTTTGTGAATAAAGTTTTATTGG - Intronic
1170765719 20:19288831-19288853 CTTTGTGAATAAAGTTTTATTGG + Intronic
1171007831 20:21484686-21484708 AATTGTTAAAAAAGTTTTATTGG + Intergenic
1172105366 20:32514100-32514122 CATTTTGAATAAAGTTTTACAGG + Intronic
1173445916 20:43118184-43118206 TTTTGTGACTAAAGTTATATTGG - Intronic
1174178643 20:48660963-48660985 CCTTATGAATAAAGTTTTATTGG + Intronic
1174319366 20:49728714-49728736 CTTTGTAAATAAAGTTTTATTGG - Intergenic
1174681611 20:52414215-52414237 TTTTGTAAGCAAAGTTTTATAGG - Intergenic
1174689426 20:52489295-52489317 CATTATAATTAAAGTTTTATTGG - Intergenic
1174745254 20:53055814-53055836 CTTTGTAAATAAAGTTTTATTGG + Intronic
1174905601 20:54547133-54547155 CTTTGTAAATAAAGTTTTATTGG + Intronic
1174916283 20:54657541-54657563 TATTGTAAATAAAGTTTTATTGG + Intergenic
1175367968 20:58468292-58468314 TTTTGTAAACAAAGTTTTATTGG - Intronic
1175650562 20:60718267-60718289 CATTTTTAGCAAAGTGTTATGGG + Intergenic
1176818006 21:13625321-13625343 CTTTGTAAATAAAGTTTTATAGG - Intronic
1176912572 21:14584574-14584596 CTTTGTGTGCTAAGTTTTATAGG + Intergenic
1178836238 21:36099987-36100009 CGGTCTGACCAAAGTTTTTTAGG - Intergenic
1179252391 21:39682951-39682973 TTTTGTGAATAAAGTTTTATTGG + Intergenic
1180475767 22:15705103-15705125 CATTGTGAGTAAAGTTTTATAGG - Intronic
1180510738 22:16086341-16086363 CATTGTGATCTGAGTATTATAGG + Intergenic
1181106008 22:20575914-20575936 CAATGTGGCCAAAGTGGTATTGG + Intronic
1181664302 22:24381408-24381430 CATTGAGAATACAGTTTTATTGG + Intronic
1181729516 22:24834383-24834405 TTTTGTGAATAAAGTTTTATTGG + Intronic
1184785005 22:46667391-46667413 CTTTGTAAATAAAGTTTTATTGG + Intronic
1185098231 22:48823036-48823058 CTTTGTAAATAAAGTTTTATTGG + Intronic
949191835 3:1259018-1259040 TTTTGTGAATAAAGTTTTATTGG - Intronic
953537757 3:43788929-43788951 TTTTGTGAGTAAAGTTTTATTGG + Intergenic
953583260 3:44176366-44176388 CACTGTAATCAAATTTTTATTGG - Intergenic
953841240 3:46391746-46391768 GAAGGTGACCAAAGGTTTATAGG + Intergenic
955222212 3:57032501-57032523 CATGGTGAGCAAAGTTTTGCTGG + Intronic
955521369 3:59778613-59778635 CTTTGTAAATAAAGTTTTATCGG - Intronic
956013347 3:64855015-64855037 TTTTGTAAACAAAGTTTTATTGG + Intergenic
956045997 3:65196493-65196515 CACTGTGACAGAAGTTTTCTGGG + Intergenic
956291511 3:67665404-67665426 CTTTGTAAATAAAGTTTTATTGG + Intergenic
956780881 3:72602175-72602197 CTTTGTAAATAAAGTTTTATTGG + Intergenic
957894643 3:86405559-86405581 TTTTGTGAATAAAGTTTTATTGG + Intergenic
958070922 3:88610246-88610268 CATTGTGTTCAAATATTTATGGG + Intergenic
958449158 3:94251957-94251979 CATTGTGGCGACAGTTTCATGGG + Intergenic
958538426 3:95434497-95434519 AATTGTGAATAAAGTTTTATTGG - Intergenic
959347203 3:105212399-105212421 CAGTGTCAATAAAGTTTTATTGG + Intergenic
960453237 3:117836891-117836913 TATTGTAAATAAAGTTTTATTGG + Intergenic
961668643 3:128510139-128510161 CATTGTGTGCAAATTTTTCTGGG - Intergenic
961852269 3:129832698-129832720 TATGGTGACCAAAGCTTTTTTGG + Intronic
962039625 3:131692543-131692565 TTTTGTGAATAAAGTTTTATTGG + Intronic
962862801 3:139420023-139420045 ACTTCTGACCAAAGTGTTATAGG - Intergenic
966303815 3:178508664-178508686 TATTGTAAATAAAGTTTTATTGG - Intronic
966331238 3:178817107-178817129 CACTGTGACCCAGGTCTTATGGG - Intronic
967249900 3:187526643-187526665 TTTTGTAAACAAAGTTTTATTGG + Intergenic
967821530 3:193843336-193843358 CTTTGTAAATAAAGTTTTATTGG + Intergenic
967875137 3:194263627-194263649 TTTTGTGAATAAAGTTTTATTGG + Intergenic
967938277 3:194746722-194746744 AGTTGTGAGCAAAGTGTTATTGG - Intergenic
967961322 3:194927144-194927166 CATTGATACAAAAGTATTATTGG - Intergenic
969380857 4:6796689-6796711 CCGTGTGACCAAACTTTTAAGGG - Intronic
970700351 4:18729720-18729742 TTTTGTAAACAAAGTTTTATTGG + Intergenic
970889533 4:21027232-21027254 CATTGTAAATAAAGTTTTATTGG + Intronic
971253193 4:24990498-24990520 CTTTGTAAATAAAGTTTTATTGG - Intergenic
971350786 4:25854198-25854220 TTTTGTAACCAAAGTTGTATGGG - Intronic
972791038 4:42371309-42371331 CATTGTGAACAAAGTGGTCTAGG + Intergenic
972822502 4:42717532-42717554 AATTGTGACCATAGTACTATGGG + Intergenic
972837696 4:42893629-42893651 CAATTTGACCAAAGTATTACAGG + Exonic
974945675 4:68525737-68525759 CTTTGTGATCAAAGTAGTATGGG - Intergenic
975931977 4:79535435-79535457 CATTCTGAGCAAACTTGTATGGG + Intergenic
976628581 4:87213678-87213700 TTTTGTAAACAAAGTTTTATTGG - Intronic
977140574 4:93366427-93366449 CAGTGTGACCAAAATTTATTAGG - Intronic
978542826 4:109837215-109837237 CTTTGTAAATAAAGTTTTATTGG - Intronic
980296570 4:130926118-130926140 CATTGTGATGAAAATTGTATTGG + Intergenic
982270079 4:153577567-153577589 TTTTGTCAGCAAAGTTTTATTGG - Intronic
982454403 4:155591436-155591458 TTTTGTGATCAAACTTTTATTGG - Intergenic
982614765 4:157626706-157626728 CATTGTGACCAAGGGATAATAGG - Intergenic
982839378 4:160163614-160163636 CATTGTGAACAAATTTTTAAAGG + Intergenic
985085028 4:186304409-186304431 CTTTGTAAATAAAGTTTTATTGG + Intergenic
986627201 5:9733240-9733262 TTTTGTGAATAAAGTTTTATTGG + Intergenic
986840704 5:11693864-11693886 CATTGTGACCAAAGGCTTGCAGG - Intronic
987523224 5:19014647-19014669 AATTATGAACAAAGTATTATTGG - Intergenic
989002814 5:36778535-36778557 CATTCTGACAACATTTTTATTGG - Intergenic
989413219 5:41143948-41143970 AATTTTGAACAAAGGTTTATAGG + Intronic
991217070 5:64167128-64167150 CATTGTCACCAAAGTATCTTTGG - Intronic
993231223 5:85239472-85239494 CATTATGTACAAAGTTTTCTTGG - Intergenic
995544467 5:113216070-113216092 TTTTGTGAATAAAGTTTTATTGG + Intronic
995825785 5:116297470-116297492 CTTTGTAAATAAAGTTTTATTGG + Intronic
997483559 5:134208746-134208768 CTTTGTAAACAAAGTTTTAAAGG - Intronic
999116310 5:149166875-149166897 CTTTGTAAATAAAGTTTTATTGG - Intronic
999575642 5:152973507-152973529 CTTTGTAAATAAAGTTTTATTGG - Intergenic
999846334 5:155484693-155484715 CATTGTTACTAAAATTTTCTAGG - Intergenic
1001145060 5:169176748-169176770 TATTGTAAATAAAGTTTTATTGG - Intronic
1001618408 5:173060868-173060890 CCTTGTAAATAAAGTTTTATTGG - Intronic
1002604561 5:180374900-180374922 TTTTGTAAACAAAGTTTTATTGG - Intergenic
1003104093 6:3200875-3200897 TGTTGTGAATAAAGTTTTATTGG + Intergenic
1004164534 6:13244410-13244432 CAGTGTGACCAAAATTTATTAGG + Intronic
1004742705 6:18477290-18477312 TATAGTTACCAAAGTGTTATTGG - Intergenic
1004933780 6:20487883-20487905 CTTTGTAAATAAAGTTTTATTGG - Intronic
1005004424 6:21273628-21273650 TATTATAAACAAAGTTTTATTGG - Intergenic
1005714003 6:28529791-28529813 CTTTGTTAACAAAGTTTTATTGG + Intronic
1006045408 6:31291589-31291611 CATTATGACCTGAGTTTTATCGG + Intronic
1008040223 6:46789612-46789634 TTTTGTGAATAAAGTTTTATTGG + Intergenic
1008449616 6:51635535-51635557 CATTGAGACCAAAGTTCCAAAGG - Intronic
1010752275 6:79629077-79629099 CTTTGTAAATAAAGTTTTATTGG - Intergenic
1011111527 6:83842157-83842179 GTTTTTGACCAAAGATTTATAGG - Intergenic
1011804633 6:91058258-91058280 TTTTGTGATCAAAGTTATATTGG - Intergenic
1011940279 6:92834413-92834435 TTTTGTAAACAAAGTTTTATTGG - Intergenic
1012356709 6:98322940-98322962 TTTTGTGAGTAAAGTTTTATTGG + Intergenic
1014173171 6:118301800-118301822 TTTTGTGAATAAAGTTTTATTGG - Intronic
1015283237 6:131456635-131456657 CATGGAGACCAAGGTTTTGTGGG + Intergenic
1017237847 6:152135914-152135936 CATTGTGACCAGAGTGTAGTCGG - Intronic
1018269411 6:162059956-162059978 CATTGTCCATAAAGTTTTATTGG + Intronic
1019844995 7:3489777-3489799 CTTTGTGATCAAATTTTAATAGG - Intronic
1021195473 7:17669669-17669691 AATTGTTACCAAGGTTTTGTTGG - Intergenic
1021977047 7:26021003-26021025 CAGTGGGCCCATAGTTTTATGGG + Intergenic
1023622051 7:42083458-42083480 CTTTGTAAATAAAGTTTTATTGG + Intronic
1023765433 7:43505983-43506005 CATTCTTACCCAAGTTTTAAAGG - Intronic
1029602644 7:101577943-101577965 TTTTGTGCCTAAAGTTTTATTGG + Intergenic
1030155775 7:106453449-106453471 CAATGTGATTAAAATTTTATAGG - Intergenic
1030418956 7:109283071-109283093 CATAGTGACCAAACTTTAACTGG - Intergenic
1030973040 7:116085442-116085464 CATTTTAAGCGAAGTTTTATGGG - Intronic
1031445691 7:121850791-121850813 CAATGTGACCAAAATATTAATGG + Intergenic
1031572768 7:123379395-123379417 GATTTTAACTAAAGTTTTATTGG + Intergenic
1032514081 7:132494227-132494249 CTTTGTGACCAAATGTCTATCGG - Intronic
1034526142 7:151664029-151664051 TTTTGTGATTAAAGTTTTATTGG - Intronic
1034829524 7:154297354-154297376 TTTTGTGAATAAAGTTTTATTGG - Intronic
1035054517 7:156025427-156025449 CTTTGTAAACAAAGTTTTATTGG - Intergenic
1035075681 7:156175843-156175865 CTTTGTAAATAAAGTTTTATTGG - Intergenic
1035659953 8:1339664-1339686 CATTGTGACCTTCGTTTAATAGG + Intergenic
1035693305 8:1573719-1573741 TTTTGTGAATAAAGTTTTATTGG + Intronic
1035971635 8:4255956-4255978 TATTTTCACCAAAGCTTTATTGG - Intronic
1036957896 8:13210377-13210399 CATTGTCAACAAACTTTTACTGG + Intronic
1036957898 8:13210421-13210443 CAATGTCAACAAACTTTTATTGG + Intronic
1037205719 8:16317750-16317772 CATTGACTCCAAAATTTTATAGG - Intronic
1037241155 8:16779440-16779462 CTTTGTAAATAAAGTTTTATTGG + Intergenic
1038901189 8:31845666-31845688 CATTCTGACCAAAGACTTTTGGG + Intronic
1039015289 8:33141258-33141280 CATTGGGATCAAAGTTTTAGAGG + Intergenic
1039122967 8:34169447-34169469 CATTGTGAACAGATTTTGATGGG - Intergenic
1039792186 8:40884807-40884829 CTTTGTAAATAAAGTTTTATTGG + Intronic
1040888765 8:52293547-52293569 CATTGTGACAAATGTTATGTTGG - Intronic
1041182972 8:55267608-55267630 AATTGTAACCAAAGTGTTAAGGG + Intronic
1042083910 8:65087595-65087617 AATTGTGACCAAAGTCCTAAAGG + Intergenic
1043299653 8:78711350-78711372 CATTTTGACCAAAATTATAAAGG - Intronic
1043319878 8:78971199-78971221 AGTTGAGAACAAAGTTTTATAGG + Intergenic
1045022483 8:98055837-98055859 TTTTGTGAATAAAGTTTTATTGG - Intergenic
1045196480 8:99936005-99936027 TATTGTGATGATAGTTTTATGGG + Intergenic
1045627064 8:104066071-104066093 TTTTGTAAACAAAGTTTTATTGG + Intronic
1046501537 8:115084247-115084269 TTTTGTGAATAAAGTTTTATTGG + Intergenic
1046763447 8:118044833-118044855 TTTTGTAAACAAAGTTTTATTGG + Intronic
1046813472 8:118557581-118557603 CATTGTGACCTGAGTTCTAGTGG + Intronic
1047447619 8:124933598-124933620 CAGTGTGACCAAAATTTATTAGG - Intergenic
1048744838 8:137602651-137602673 TTTTGTGAATAAAGTTTTATTGG + Intergenic
1048821115 8:138381678-138381700 CTTTCTGATCAAAGTTTTCTGGG + Intronic
1049173649 8:141177699-141177721 CTTTGTAAGTAAAGTTTTATTGG + Intronic
1050437449 9:5626006-5626028 TATTGTGACAAAAATGTTATTGG - Intergenic
1053705196 9:40746230-40746252 CATAGAAACCAAAGTTTTTTTGG - Intergenic
1054415273 9:64869837-64869859 CATAGAAACCAAAGTTTTTTTGG - Intergenic
1055852422 9:80648361-80648383 CATTGTAACCAGAGTTTTGTAGG + Intergenic
1056150597 9:83783859-83783881 AATTCTTACTAAAGTTTTATGGG + Intronic
1056251254 9:84750572-84750594 CATTGTAAATAAAGTTTTATTGG + Intronic
1057556132 9:96089179-96089201 TATTGTAAATAAAGTTTTATCGG - Intergenic
1057985631 9:99710920-99710942 TTTTGTGACTAAAGTTTTATTGG - Intergenic
1058458346 9:105159061-105159083 CTTTGTAAATAAAGTTTTATTGG + Intergenic
1058626590 9:106939721-106939743 CAATGTGACCAAAGCTGTAGGGG + Intronic
1060373941 9:123101863-123101885 AACTGTGACCAAAGTTTAAAAGG - Intronic
1060387789 9:123248625-123248647 CATTGTTACCCTATTTTTATAGG - Intronic
1062126920 9:134868902-134868924 GTTTGTGAATAAAGTTTTATCGG + Intergenic
1062348622 9:136127637-136127659 AAATGGGACCAAAGTTTTGTGGG + Intergenic
1203529353 Un_GL000213v1:124182-124204 CTTTGTAAATAAAGTTTTATAGG + Intergenic
1186162235 X:6789446-6789468 CATTGTGTCCCAAGTTTAATGGG + Intergenic
1186498282 X:10030078-10030100 CTTTGTAAATAAAGTTTTATTGG - Intronic
1186578541 X:10792208-10792230 TTTTGTAACCAAAGTTTTATTGG - Intronic
1186633062 X:11371301-11371323 TATTGTAAATAAAGTTTTATTGG + Intronic
1186644236 X:11489569-11489591 TATTGTAAATAAAGTTTTATTGG - Intronic
1187116189 X:16353899-16353921 TTTTGTAAACAAAGTTTTATTGG + Intergenic
1187291405 X:17957383-17957405 CTTTGTAAATAAAGTTTTATTGG + Intergenic
1187409092 X:19032777-19032799 TTTTGTGAATAAAGTTTTATTGG - Intronic
1188391421 X:29625106-29625128 TATTGTAAAGAAAGTTTTATTGG - Intronic
1189020996 X:37339682-37339704 CACTGGGACCAAACATTTATTGG + Intergenic
1190167428 X:48084774-48084796 AATTGTGACCAAAATCTTAAAGG - Intergenic
1190430073 X:50370425-50370447 CAGAGTGTCCAGAGTTTTATTGG - Exonic
1191980865 X:66924020-66924042 CAGTCTGACCAAAATTTTTTAGG - Intergenic
1193651612 X:84141234-84141256 CTTTGTAAATAAAGTTTTATTGG - Intronic
1193837998 X:86370347-86370369 AATTGTGTCCAACGTTTTAAGGG + Intronic
1194394424 X:93363680-93363702 CATTGTGACCCAAATATTGTCGG - Intergenic
1194452308 X:94059559-94059581 CATTGTAACAAATGTTTGATTGG - Intergenic
1197801540 X:130354685-130354707 TGTTGTGAATAAAGTTTTATTGG + Intronic
1200070016 X:153524456-153524478 TCTTGTGAATAAAGTTTTATTGG - Intronic