ID: 1110593808

View in Genome Browser
Species Human (GRCh38)
Location 13:77295449-77295471
Sequence CTTGAGACACAGATGGATCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 385
Summary {0: 1, 1: 0, 2: 12, 3: 58, 4: 314}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110593808_1110593818 27 Left 1110593808 13:77295449-77295471 CCCGGATCCATCTGTGTCTCAAG 0: 1
1: 0
2: 12
3: 58
4: 314
Right 1110593818 13:77295499-77295521 CCAACCTTTCATTTTATTTTAGG 0: 1
1: 0
2: 4
3: 74
4: 639

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110593808 Original CRISPR CTTGAGACACAGATGGATCC GGG (reversed) Intronic
900181844 1:1314579-1314601 CATGAGAGACAGAAGGAGCCTGG + Intronic
900291965 1:1927456-1927478 CTTCAGACACAGCTGGATCCAGG - Intronic
901474111 1:9477304-9477326 CTTCAGGCAGAGGTGGATCCAGG - Intergenic
901783847 1:11611757-11611779 CTTCAGACACAGCTGAATCCAGG + Intergenic
902148577 1:14423996-14424018 CTTAAGGCACATATGTATCCAGG - Intergenic
902200517 1:14830123-14830145 CTTCAGGCACAGCTGGATCCAGG + Intronic
902203950 1:14853681-14853703 CAAGAGACACAGCTGGAGCCTGG - Intronic
902257099 1:15196976-15196998 CTTCAGACACAGCGGGATCCAGG + Intronic
902438856 1:16416132-16416154 CTTGTGGCACAGATGGATGAAGG - Intronic
903663092 1:24990639-24990661 CTTCAGGCACAGATGGATCCGGG + Intergenic
904379919 1:30103651-30103673 CTTGAGTGATAGATGGTTCCTGG - Intergenic
905865393 1:41373741-41373763 CATGGGACACAGATGTCTCCAGG - Intronic
906137429 1:43509180-43509202 CTTCAGGCTCAGCTGGATCCAGG + Intergenic
907856496 1:58308548-58308570 CTTGAGACTCACATGCATTCTGG - Intronic
908120073 1:60978080-60978102 CTTCAGACACAGCTTGACCCAGG + Intronic
909155629 1:72071859-72071881 CTTGTGACACAGAGGAATACTGG - Intronic
910688166 1:89939484-89939506 CCTGAGAGGCAGATGGTTCCTGG - Intergenic
912221109 1:107676540-107676562 CTTCAGGCAGAGATGGATCCAGG - Intronic
914334473 1:146701921-146701943 CTTCAGGCACAGCTTGATCCAGG + Intergenic
917330881 1:173879216-173879238 CTTAAGACACTGCTGGATTCTGG - Intronic
918057273 1:181032880-181032902 CTTGAGACAGAGAGCTATCCTGG - Intergenic
919236096 1:194844315-194844337 GTTGAGAAGCAGATGGATGCTGG + Intergenic
919690895 1:200527504-200527526 CTTCAGACACAGCTGGATCCAGG + Intergenic
920122416 1:203668656-203668678 CCAGTGACACAGATGGGTCCTGG + Intronic
921745662 1:218737699-218737721 ATTGAGTCACAGATAAATCCTGG + Intergenic
1062836084 10:636758-636780 CCTGAGAGACAGATGCATCTGGG - Intronic
1064097700 10:12436136-12436158 CTTGAGTCACAGATGAAGCCGGG - Intronic
1065244206 10:23741301-23741323 CTTGAGGCATGGCTGGATCCAGG - Intronic
1069097558 10:64278050-64278072 CATGTGACACAGAAGGAGCCAGG - Intergenic
1069510376 10:69037706-69037728 CTTCAGGCACAGCTGGGTCCAGG - Intergenic
1069958113 10:72063906-72063928 TTTGGGATACAGAAGGATCCTGG - Intronic
1070539334 10:77404972-77404994 TTTCAGGCACAGCTGGATCCGGG - Intronic
1071727667 10:88216333-88216355 CTTCAGGCACAGCTGGATCTAGG + Intergenic
1072078038 10:91998573-91998595 CTTGAAACACAGAAAGAGCCAGG + Intronic
1072247017 10:93552777-93552799 CTTTAGGCACATCTGGATCCAGG - Intergenic
1072337619 10:94412929-94412951 CTTGAGACCCAAGTAGATCCTGG + Intronic
1074200156 10:111227444-111227466 CTTCAGGCATGGATGGATCCAGG + Intergenic
1074369563 10:112888958-112888980 CTTCAGGCACAGCTGTATCCAGG - Intergenic
1075099264 10:119494444-119494466 CTTCACACACAGCTGGAGCCAGG - Intergenic
1075311354 10:121416520-121416542 CTTCAGATACAGCTTGATCCAGG - Intergenic
1075674462 10:124286787-124286809 CTTCAGGCTCAGCTGGATCCAGG + Intergenic
1076419979 10:130324437-130324459 TTTCAGGCACAGCTGGATCCAGG - Intergenic
1076515132 10:131041188-131041210 GATGAAACACAGATGGACCCTGG - Intergenic
1079623218 11:22581212-22581234 CTTGAGACAGAGATGCATAGTGG + Intergenic
1081301881 11:41462673-41462695 TTTGATACACAGAGGGGTCCTGG + Intergenic
1081703448 11:45166161-45166183 CTTCAGGTACAGTTGGATCCAGG + Intronic
1084330851 11:68429368-68429390 ATTGACACACAAATGGATGCCGG - Intronic
1084404635 11:68964125-68964147 CATCAGACATAGCTGGATCCTGG - Intergenic
1084409834 11:69000396-69000418 CTTCAGACACAGCTGGATCCAGG - Intergenic
1084558401 11:69889061-69889083 CTCTAGACACACATGGATCTGGG - Intergenic
1084581093 11:70023997-70024019 CTTCAGACATAGCTGAATCCGGG + Intergenic
1085174763 11:74476097-74476119 CTTCAGGCACAGATTGATCCAGG - Intergenic
1085450397 11:76628789-76628811 CCTGACACACAGGTGGGTCCAGG - Intergenic
1085971213 11:81593123-81593145 CTTTAGGCATGGATGGATCCAGG + Intergenic
1086739992 11:90354699-90354721 CTTCAGGAACAGGTGGATCCTGG + Intergenic
1089834050 11:121354370-121354392 CTTCAGGCACAGCTGGATCCAGG - Intergenic
1089979396 11:122759816-122759838 CCTGAGCCACAGATGGGTACTGG - Intronic
1090652536 11:128820092-128820114 CTTCAGATACAAATAGATCCTGG - Intergenic
1096482801 12:51953072-51953094 ATTGACCCACAGATGGATCTGGG + Intronic
1097309976 12:58108503-58108525 CTTAAGACACAGCTGAATTCAGG + Intergenic
1098368562 12:69733383-69733405 CTTCAGTCACAGGTTGATCCAGG + Intergenic
1100019067 12:90047919-90047941 CTTTAGGCACAGATGGCTCCAGG - Intergenic
1100255498 12:92879178-92879200 CTTGAGACACTTTTGGATTCTGG + Intronic
1101506662 12:105353180-105353202 CTGTAGTCACAGCTGGATCCAGG + Intronic
1101738497 12:107481714-107481736 CCTTTGACACAGCTGGATCCAGG + Intronic
1101763581 12:107678845-107678867 CTTCAGACATAGCTGGATCTAGG - Intergenic
1102175894 12:110874528-110874550 CTTCAGGCATAGCTGGATCCAGG + Intronic
1102256846 12:111420467-111420489 CCTGAGTCAAAGATGGAGCCTGG - Intronic
1102525177 12:113507522-113507544 CTTCAGGCACAGTTGGATCCAGG + Intergenic
1102542573 12:113633202-113633224 CTTCAGGCATAGCTGGATCCAGG + Intergenic
1102560381 12:113757815-113757837 CTTCAGGCACAGCTGGATCCAGG - Intergenic
1102705409 12:114876172-114876194 CCTGAGGCAGAGATGGAGCCGGG + Intergenic
1102891550 12:116562263-116562285 TTTCAGGCACAGGTGGATCCAGG - Intergenic
1103267573 12:119643890-119643912 CTTCAGAGGCAGCTGGATCCTGG + Intergenic
1103845692 12:123900710-123900732 CTTCAGGCACAGCTGGATCTAGG + Intronic
1103942661 12:124509396-124509418 CTTCAGGCACAGTTGGGTCCAGG - Intronic
1103975965 12:124702944-124702966 CTTCAGGTACAGCTGGATCCAGG + Intergenic
1103979266 12:124726021-124726043 CTTCAGGCATAGCTGGATCCAGG + Intergenic
1103982286 12:124744426-124744448 TTTCAGGCACAGCTGGATCCAGG + Intergenic
1104086008 12:125474735-125474757 CTTTAGGCACAGCTGGATCCAGG + Intronic
1104216632 12:126740273-126740295 CTTCAGGCTCAGATGGATTCAGG - Intergenic
1104377415 12:128277259-128277281 CTTCAGGCACAGCTGGATCCAGG + Intronic
1104420617 12:128631669-128631691 CTTCAGGCACAGTTGGTTCCAGG + Intronic
1104434515 12:128745178-128745200 CTTCAGGCATAGCTGGATCCAGG + Intergenic
1104517978 12:129445613-129445635 CTTCAGGCACAGCTGGATCCAGG - Intronic
1104684720 12:130777415-130777437 CTTCAGACCCAGCTGGATCCTGG + Intergenic
1104703899 12:130928345-130928367 CTGCAGGCACAGCTGGATCCAGG - Intergenic
1105008891 12:132741111-132741133 CGAGAGAGACCGATGGATCCAGG + Intronic
1106016322 13:25872402-25872424 CTTCAGGCAGAGCTGGATCCAGG - Intronic
1110593808 13:77295449-77295471 CTTGAGACACAGATGGATCCGGG - Intronic
1110879961 13:80559407-80559429 CTTGGGACAGAGATTGAGCCTGG + Intergenic
1111381956 13:87467409-87467431 CTAGAGAGACAGACTGATCCAGG + Intergenic
1117694097 14:58340778-58340800 CTTAAGACACAGGTGGGGCCGGG - Intronic
1118702422 14:68446799-68446821 CCTGAGGCACAGTTGGATCCAGG - Intronic
1118752663 14:68817977-68817999 TTGGAGAAACAGCTGGATCCTGG - Intergenic
1119531431 14:75364064-75364086 CTTTAGGAACAGCTGGATCCAGG + Intergenic
1119683670 14:76612890-76612912 ATTCAGGCACAGCTGGATCCGGG + Intergenic
1121632279 14:95430205-95430227 CTTGACACCCACATGGATCCTGG + Intronic
1122127294 14:99586237-99586259 CTTGGGAGACAGATGGGGCCTGG - Intronic
1123627393 15:22237230-22237252 CTTCAGGCACAACTGGATCCAGG - Intergenic
1124477507 15:30047549-30047571 CTTCAGACAGAGCTGGATACAGG + Intergenic
1125432503 15:39609595-39609617 CTAGAGAAACACATGGATGCAGG - Intronic
1128786917 15:70404354-70404376 CCTGAGGCACAGATGGATCCAGG - Intergenic
1129111615 15:73340337-73340359 CTGGAGACACGAATGGATGCTGG + Intronic
1129152089 15:73695750-73695772 CTTCAGGCATAGCTGGATCCAGG + Intronic
1130849838 15:87782172-87782194 CTTCAGGCACAGCTGGAACCAGG + Intergenic
1131768975 15:95714254-95714276 CTGGAGAAAAAGATGGGTCCTGG + Intergenic
1132104893 15:99056338-99056360 CTTCGGAGCCAGATGGATCCTGG + Intergenic
1132182206 15:99765163-99765185 CTTGTTTCACAGACGGATCCAGG + Intergenic
1132215318 15:100057878-100057900 CTTCAGGCACTGCTGGATCCAGG - Intronic
1133431461 16:5740610-5740632 CTTCAGGCATAGCTGGATCCAGG + Intergenic
1133532919 16:6672621-6672643 CTTCAGGTACACATGGATCCAGG + Intronic
1133661398 16:7921450-7921472 CTTAAGGTACAGCTGGATCCAGG - Intergenic
1134037384 16:11041420-11041442 CTTCAGGCAAAGCTGGATCCAGG + Intronic
1134410712 16:14001263-14001285 CTTCGGGCACAGCTGGATCCAGG + Intergenic
1134862434 16:17572498-17572520 CTTAAGTCACAGAAGCATCCTGG - Intergenic
1135048843 16:19176091-19176113 CTTCAGGCATAGCTGGATCCAGG + Intronic
1135353538 16:21750473-21750495 GTTCAGATACAGCTGGATCCAGG + Intronic
1135452026 16:22566600-22566622 GTTCAGATACAGCTGGATCCAGG + Intergenic
1135806113 16:25544454-25544476 CTTCAGGCATAGCTGGATCCAGG + Intergenic
1135875623 16:26197383-26197405 CTTCAGGCATAGTTGGATCCAGG - Intergenic
1135978752 16:27129845-27129867 TTTCAGGCACAGTTGGATCCAGG + Intergenic
1136064130 16:27747397-27747419 CTTTAGGCACAGCTGGATCCAGG + Intronic
1136079686 16:27843678-27843700 CTTCAGACACAGCTGGATCCAGG - Intronic
1136084606 16:27875949-27875971 CTTCAGGCACAGCTGCATCCAGG - Intronic
1136105932 16:28030550-28030572 CTTCAGTCTCAGCTGGATCCAGG - Intronic
1136106593 16:28034461-28034483 CTTCAGTCTCAGCTGGATCCAGG + Intronic
1137374610 16:47941899-47941921 CTTCAGGCACAATTGGATCCAGG + Intergenic
1137520478 16:49191015-49191037 CTTCAGATACAAATGGATTCAGG + Intergenic
1138447285 16:57072099-57072121 CTTCAGGCACAGCTGGATCCAGG + Intronic
1138519953 16:57565429-57565451 CTTCAGACATAGCTGGATCCAGG + Intronic
1138600738 16:58052400-58052422 CTTTAGGCACGGCTGGATCCAGG - Intergenic
1139999148 16:71009311-71009333 CTTCAGGCACAGCTTGATCCAGG - Intronic
1140198574 16:72876268-72876290 CTTCAGCCACAGATGGCTCAGGG + Intronic
1140855071 16:78970848-78970870 CTTCAGGCACGGCTGGATCCAGG + Intronic
1141293943 16:82749236-82749258 CTTTAGGTACAGCTGGATCCAGG - Intronic
1141610980 16:85181139-85181161 GATGAGACCCAGAAGGATCCCGG - Intronic
1142124806 16:88404968-88404990 CTTCAGGCATAGCTGGATCCAGG + Intergenic
1142722546 17:1786332-1786354 CTTAAGATACAGCTTGATCCAGG - Intronic
1142879124 17:2870797-2870819 CCTCAGAAACAGCTGGATCCAGG + Intronic
1143606363 17:7988705-7988727 CTTCAGGCACAGCTGGATTCAGG - Intergenic
1143606815 17:7991705-7991727 CTTCAGGCACAGCTGGATTCAGG + Intergenic
1143849257 17:9797440-9797462 AATTAGAAACAGATGGATCCTGG + Intronic
1144329712 17:14212658-14212680 CCTGTGACAGAGATGGAGCCCGG - Intergenic
1146221027 17:31020710-31020732 TTTTAGGCACAGCTGGATCCCGG + Intergenic
1146636629 17:34511251-34511273 CTTCAGGCACATCTGGATCCAGG + Intergenic
1149488058 17:57059882-57059904 CTTCAGACACAGTTGGATCCAGG - Intergenic
1150366726 17:64594425-64594447 TTTTAGGCACAGCTGGATCCCGG - Intronic
1151475044 17:74340506-74340528 GTTGAGACACAGAAGGGTCCTGG - Intronic
1151619887 17:75239291-75239313 CATGCGACAGGGATGGATCCAGG - Intronic
1153378188 18:4405721-4405743 CTCAAGACAAAGATGGGTCCAGG + Intronic
1153444112 18:5153026-5153048 CTTGAAACACAGATGGACTTTGG + Intronic
1154251880 18:12751594-12751616 CTTCAGACACAACTGGATCGGGG + Intergenic
1154505650 18:15038245-15038267 CTTGAGAAACAGAAGGACCAAGG - Intergenic
1155128501 18:22904420-22904442 CTTGAGACACAGAAGAAGACTGG + Intronic
1156248958 18:35332424-35332446 CTTTAGGCACAGCTGGATCTAGG + Exonic
1157947276 18:51994563-51994585 CTTGAGACATAAATAGATCTTGG - Intergenic
1160678507 19:402964-402986 CTTCAGGCATAGCTGGATCCAGG + Intergenic
1160737577 19:671018-671040 GTTCAGGCACAGCTGGATCCAGG + Intergenic
1160849953 19:1185871-1185893 TTTCAGACACAGCTGGATCCAGG + Intronic
1160926989 19:1551259-1551281 TTTCAGGCACAGCTGGATCCAGG + Intergenic
1160938169 19:1607454-1607476 CTTCAGGCACAGCTGGATCCAGG - Intergenic
1161455179 19:4366376-4366398 CTTCAGGCACAGCTGGATCCCGG - Intronic
1161623881 19:5314417-5314439 CTTCAGGCATAGTTGGATCCAGG - Intronic
1162019503 19:7862266-7862288 CTTGAGACGCAGGTGGACTCGGG + Exonic
1162055068 19:8057725-8057747 CTTCAGGCTCAGCTGGATCCAGG + Intronic
1162496879 19:11028313-11028335 CTTCAGGCACAGCTGGATCCAGG + Intronic
1162556740 19:11391466-11391488 CTTCAGGCACAGTTGCATCCAGG - Intronic
1162882234 19:13668305-13668327 CTTCAGGCTCAGCTGGATCCAGG + Intergenic
1162928368 19:13942223-13942245 CTTCAGGCACAGCTGGATCCAGG + Intronic
1163183338 19:15619110-15619132 CTTCAGGCACAACTGGATCCAGG + Intronic
1163399918 19:17085999-17086021 CATGAGACACAGGTGGGTTCTGG - Intronic
1163654137 19:18535872-18535894 CTTCAGGCATAGCTGGATCCAGG - Intronic
1163668893 19:18616237-18616259 CTTCAGGCACAGCTGGATCCAGG + Intronic
1164678764 19:30120238-30120260 CTTCAGGCACAGCTGGATCCAGG - Intergenic
1165184650 19:34007286-34007308 GATGAGACACAGCTGGAGCCTGG + Intergenic
1165339385 19:35199809-35199831 CTTCAGACATAGTTGTATCCAGG - Intergenic
1165341546 19:35215809-35215831 CTTCAGGCACAGTTAGATCCAGG - Intergenic
1166342340 19:42146222-42146244 CTGGAGACACAGATGGAACCAGG + Intronic
1166770593 19:45279735-45279757 CTTCAGGCACAGTTGTATCCAGG + Intronic
1167090737 19:47341866-47341888 CTTCAGGCATAGCTGGATCCAGG + Exonic
1167097180 19:47380734-47380756 CTTCAGGCACAGCTGGATCCAGG + Intronic
1167215552 19:48162093-48162115 CTGCAGGCACAGCTGGATCCAGG - Intronic
1167536184 19:50053334-50053356 CTTCAGGAACAGATGGATCCAGG - Intronic
1167536778 19:50058605-50058627 CTTCAGGAACAGATGGATCCAGG - Intergenic
1167702474 19:51058182-51058204 CTTTAGGCACAGATGGATCCAGG - Intronic
1167745830 19:51351360-51351382 CTTCAGGCACAGCTTGATCCAGG - Intronic
1168070413 19:53947204-53947226 ATTGATAAACAGATGGAACCAGG - Intergenic
926577680 2:14600348-14600370 CTGGATTAACAGATGGATCCTGG + Intergenic
926751790 2:16204032-16204054 CTTGAGCCGCTGAAGGATCCTGG - Intergenic
926995626 2:18732422-18732444 CTGGAGACACAGAAGGATTGGGG + Intergenic
927142360 2:20139172-20139194 GTTGAGACACAGCTGGATTCAGG + Intergenic
930020797 2:47000977-47000999 CTGGAGGCACAGAAGGAGCCAGG + Intronic
932224895 2:70031757-70031779 CTTAAGGCACAGTTAGATCCAGG + Intergenic
932399300 2:71468712-71468734 CTTGAGAGCCAGGGGGATCCAGG - Intronic
935670655 2:105554246-105554268 CTTGAGCCAAAGTTGGCTCCAGG + Intergenic
936023576 2:109014241-109014263 GTTGAGAGACACAAGGATCCTGG + Intergenic
936462087 2:112721638-112721660 CTTCAGACACACATGGGTCCAGG + Intronic
938122330 2:128642720-128642742 CCTGTGACCCAGATGGATCTGGG - Intergenic
938948737 2:136238154-136238176 CTTCAGGTAAAGATGGATCCAGG + Intergenic
942399005 2:175581328-175581350 CACCAGACACAGATGGAGCCAGG + Intergenic
945948879 2:216020288-216020310 CTTTAGACATAACTGGATCCAGG + Intronic
946865993 2:224041111-224041133 ATTGAGACAGAAATGGATGCAGG - Intergenic
947343185 2:229161342-229161364 AGTTAGACACAGCTGGATCCAGG - Intronic
948108063 2:235430899-235430921 CTTCAGGAACAGCTGGATCCAGG - Intergenic
948351610 2:237345594-237345616 CTTTAGACACGGAGGGAGCCAGG - Intronic
948772125 2:240256997-240257019 TTTCAGGCACAGCTGGATCCAGG + Intergenic
1168892508 20:1304035-1304057 CCCGAGTCACAGATGAATCCAGG - Intronic
1168928721 20:1604172-1604194 CTTGTGGCACAGACAGATCCAGG + Intronic
1168983793 20:2030073-2030095 CTTCAGGAACAGGTGGATCCAGG + Intergenic
1169035786 20:2450928-2450950 GTTGAGAGACAGATGAATTCTGG - Intergenic
1170940957 20:20847820-20847842 CTCCTGACACAGATGGATGCAGG + Intergenic
1171064608 20:22002324-22002346 CTTGCAACACAGAAGGATCTCGG - Intergenic
1172630187 20:36373251-36373273 CTTCAGGCTCAGCTGGATCCAGG + Intronic
1172776899 20:37413211-37413233 GTGGAGAGAGAGATGGATCCGGG - Intergenic
1173705954 20:45110473-45110495 CTTGTGACACAGGTGGTTCATGG + Exonic
1173942320 20:46921779-46921801 CTTCAGGAACAGCTGGATCCAGG - Intronic
1174085219 20:48003199-48003221 CTTCAGGCATGGATGGATCCAGG + Intergenic
1174113667 20:48212989-48213011 CTTCAGGCACAGCTGCATCCAGG + Intergenic
1174168188 20:48599552-48599574 CTTCAGGCACAGCTGCATCCAGG - Intergenic
1174200573 20:48803843-48803865 CCTCAGGCACAGTTGGATCCAGG - Intronic
1174412873 20:50347204-50347226 CTTCAGATACAGCTGGATCCAGG - Intergenic
1174451221 20:50621732-50621754 CTTTAGACATAGCTAGATCCAGG - Intronic
1174518219 20:51109606-51109628 CTTCAGGCATGGATGGATCCAGG - Intergenic
1174670570 20:52303989-52304011 CTTGAGTCACAGAAAAATCCAGG + Intergenic
1175117589 20:56694048-56694070 CTTCAGGCACAGATGGATCTAGG + Intergenic
1175118195 20:56698699-56698721 CTTCAGGTACAGCTGGATCCGGG + Intergenic
1175122322 20:56725276-56725298 CTTCAGGCACGGCTGGATCCAGG + Intergenic
1175228460 20:57459163-57459185 CTTCAGGCACAGATGGATCCAGG + Intergenic
1175304187 20:57964798-57964820 CTGCAGGCACAGCTGGATCCAGG + Intergenic
1175831335 20:61966678-61966700 CTTCAGGCACGGCTGGATCCAGG + Intronic
1176056594 20:63152241-63152263 CTTGGGACCAAGATGGAGCCAGG + Intergenic
1176070358 20:63223026-63223048 TTTCAGACTCAGCTGGATCCTGG - Intergenic
1176119806 20:63449200-63449222 CTTCAGGCACAGCTGGATCCAGG - Intronic
1176792211 21:13330871-13330893 CTTGAGAAACAGAAGGACCAAGG + Intergenic
1177451561 21:21274771-21274793 CTTAAGACACTGATTGATCTTGG - Intronic
1177991606 21:28041735-28041757 CTTGAGAAACAGAAGGACCAAGG + Intergenic
1181733782 22:24866532-24866554 CTTCAGGCATGGATGGATCCAGG + Intronic
1182533231 22:30978764-30978786 CTTCAGGCACGGTTGGATCCAGG - Intergenic
1182756547 22:32684364-32684386 CTTCAGGCACAGCTGGATCTAGG - Intronic
1182884174 22:33759151-33759173 CTTCAGGCAGAGTTGGATCCAGG - Intronic
1183232934 22:36594088-36594110 CTTCAGGCACAGATGGATCCAGG + Intronic
1184092231 22:42298891-42298913 CTTGAGGCAGGGATGGCTCCTGG - Intronic
949876078 3:8626855-8626877 CTTCAGGCCCAGCTGGATCCGGG - Intronic
949921821 3:9009049-9009071 CTTCAGGCACAGCTGGATCCAGG - Intronic
950047814 3:9960879-9960901 CTTCAGGCACAGCTGGGTCCAGG - Intergenic
950132761 3:10558578-10558600 CTTCAGGCACAGCTGGATCCAGG - Intronic
952463177 3:33551340-33551362 CTGGCCAAACAGATGGATCCAGG - Exonic
954294749 3:49668025-49668047 CCTGTGCCACAGAGGGATCCGGG - Exonic
955352003 3:58200494-58200516 CTTCAGGCATAGCTGGATCCAGG - Intronic
955511484 3:59685327-59685349 CTTCAGGCACAGATGGATCCAGG + Intergenic
955527156 3:59832911-59832933 CTTCAGGCACAGCTGGATTCAGG - Intronic
955809087 3:62767608-62767630 TTTGTGACACAGATGGAAGCTGG + Intronic
955999061 3:64709439-64709461 CTTCAGGCACAGTTGGATCCAGG + Intergenic
956297016 3:67726015-67726037 CTTGAGGCACAGGTGGATCTAGG + Intergenic
956547157 3:70417570-70417592 CTTCAGACATAGGTGGATCCAGG + Intergenic
956656795 3:71560095-71560117 CTTCAGGTACAGATGGAGCCAGG - Intronic
956663110 3:71618483-71618505 CTCTAGTCACAGATGGATCATGG - Intergenic
956668623 3:71664966-71664988 CTTCAGGCACAGCTTGATCCAGG - Intergenic
956894350 3:73644545-73644567 CTTCAGGCACAGATGGATTCAGG - Intergenic
959111827 3:102132007-102132029 CCTTAGGCACTGATGGATCCTGG + Intronic
959926525 3:111927772-111927794 CTTGATAAACAGATGGTTCAAGG - Intronic
961368072 3:126413939-126413961 CTTTAGGCACAGCTGGATCCAGG + Intronic
961515315 3:127428752-127428774 CTTCAGGCACAGCTGGATCCAGG + Intergenic
961517655 3:127448209-127448231 CTTCTGGCACAGCTGGATCCAGG + Intergenic
961558069 3:127710220-127710242 CTTCAGACATGGCTGGATCCAGG - Intronic
961619870 3:128215691-128215713 CTTTAAGCACAGCTGGATCCAGG + Intronic
961741285 3:129034580-129034602 CTTCAGGCACAGCTGGGTCCAGG + Intronic
962704980 3:138034306-138034328 CTTCAGACACAGCTGAATCAAGG + Intergenic
962756284 3:138467750-138467772 GGTGAGGCACAGATGGCTCCAGG + Intronic
963651190 3:147982314-147982336 CTTCAGACACACTTGGATCCAGG + Intergenic
964222430 3:154362855-154362877 ATTGACACATGGATGGATCCAGG - Intronic
964807145 3:160622890-160622912 CTTCAGGGACAGATGAATCCAGG - Intergenic
964989040 3:162783781-162783803 AGTCAGACAAAGATGGATCCAGG - Intergenic
966264098 3:178016901-178016923 GTTGAGACACAAATGGAACCTGG + Intergenic
967070418 3:185958018-185958040 ATTGAGACACAGATAGGTACTGG - Intergenic
968736747 4:2301235-2301257 CTTGAGACACAGATGAGTGGGGG + Intronic
969298500 4:6283452-6283474 CTTCAGGCACGGCTGGATCCAGG + Intronic
969377822 4:6774737-6774759 TTTGAGATAGAGTTGGATCCCGG - Intergenic
970101479 4:12527562-12527584 CTTGAGAGGGTGATGGATCCAGG - Intergenic
970325646 4:14920636-14920658 CTTGAGACACAGTTATCTCCAGG - Intergenic
972329288 4:38049614-38049636 TTTCACACACAGATGGCTCCTGG - Exonic
972338347 4:38128613-38128635 ACTGGGACACAGCTGGATCCTGG + Intronic
972763214 4:42127548-42127570 CTTGAGAAACAAATGGAGACAGG + Intronic
973723943 4:53753543-53753565 CTTGAGAGACAGATTGATACAGG + Intronic
975283432 4:72589760-72589782 TTTGAGAAACAGTTGGATCTGGG + Intergenic
975618334 4:76270108-76270130 CTTCAGGCACAGCTGGATCCAGG + Intronic
975856200 4:78627268-78627290 CTTTAGGCACAGCTGGATTCAGG + Intergenic
976331377 4:83834713-83834735 CTTTAGCCACAGATGCATCTTGG + Intergenic
976832222 4:89328407-89328429 CTTCAGGCACAGGTTGATCCAGG + Intergenic
977035109 4:91940979-91941001 CATGAGACAAAGATGAAGCCTGG + Intergenic
981035609 4:140165424-140165446 CTTTAGGCTCAGCTGGATCCAGG - Intergenic
981551588 4:145947000-145947022 CTTGATATACAGCTGGATTCAGG + Intergenic
981761306 4:148198505-148198527 ATTGAGACCCAGATGGACCCTGG - Intronic
982286505 4:153741556-153741578 CTAGAGAGACAGATGAATGCAGG - Intronic
985329499 4:188814545-188814567 CTTGAGAGACACTTGGTTCCTGG - Intergenic
986083911 5:4423540-4423562 CTTGAGAGACAAATAGATTCTGG - Intergenic
992385895 5:76284528-76284550 TTTGAGGCACAGGTGGATCCAGG - Intronic
992387285 5:76297336-76297358 CTTTAGACACAGAATGCTCCTGG + Intronic
992419608 5:76589551-76589573 CTACAGACAGAGATGGATGCAGG - Intronic
993165351 5:84346909-84346931 CTTCAAACACAGGTGGATCCAGG - Intronic
993749151 5:91645321-91645343 CTTGAGATAGAGAATGATCCTGG - Intergenic
994074620 5:95636646-95636668 CTTCAGGCAGAGCTGGATCCAGG + Intergenic
995305177 5:110638638-110638660 CTTGAGAGAGAGAGAGATCCAGG - Intronic
997516683 5:134495014-134495036 CTTCAGGCACAGTTTGATCCAGG - Intergenic
997702707 5:135915163-135915185 CTTCAGACATGGCTGGATCCAGG + Intergenic
997726743 5:136127251-136127273 CTTCAGGTACAGCTGGATCCAGG + Intergenic
998765040 5:145477217-145477239 CTTCAGGTACAGCTGGATCCAGG + Intronic
998918227 5:147039432-147039454 CTGAAGACCCAGATAGATCCCGG + Intronic
999667203 5:153925316-153925338 CTTTAGGCATAGCTGGATCCAGG - Intergenic
1000194332 5:158943118-158943140 CATGAGTCACAAATGAATCCAGG + Intronic
1000278372 5:159760450-159760472 CTTCAGGCACAGATGGGTTCAGG - Intergenic
1000810411 5:165854499-165854521 CTTCAGGCACAGCTAGATCCAGG - Intergenic
1001050661 5:168411524-168411546 CTTCAGGCACAGCTGGATCCAGG + Intronic
1001146625 5:169190374-169190396 CTTCAGGAACAGCTGGATCCAGG - Intronic
1001198762 5:169697186-169697208 CTTCAGGCATAGCTGGATCCAGG + Intronic
1001337120 5:170808209-170808231 CTTGAGAAACAGATGGTCACAGG + Intronic
1001404093 5:171463377-171463399 CTTCAGGCAAAGCTGGATCCAGG + Intergenic
1001441186 5:171744238-171744260 CTTCAGGAACTGATGGATCCAGG + Intergenic
1001452817 5:171839273-171839295 CTTCAGGCACAGCTGGATCCAGG + Intergenic
1001454505 5:171850336-171850358 CTTTAGGCACAGCTGGATCCAGG - Intergenic
1001757526 5:174182009-174182031 CTTCAGGCTCAGCTGGATCCAGG + Intronic
1002080631 5:176735200-176735222 CTTCAGGCCCAGCTGGATCCAGG - Intergenic
1002082745 5:176747358-176747380 CTTCAGGCACAGCTGGATCCAGG + Intergenic
1002087027 5:176782412-176782434 CATGAGGCACAGCTGGATTCAGG + Intergenic
1002129688 5:177072849-177072871 CTTCAGGCATAGCTGGATCCAGG - Intronic
1002937785 6:1688105-1688127 GGTGAGACACAGCTGGATTCTGG + Intronic
1003285603 6:4731445-4731467 GATGAGACACAGAGGGAGCCAGG - Intronic
1003917811 6:10804005-10804027 CCTGACACACAGATGGAACAGGG - Intronic
1004317779 6:14605516-14605538 CTTCAGACATGGCTGGATCCAGG - Intergenic
1005414162 6:25583546-25583568 CTGGAGACATAGATGGATGAAGG + Intronic
1006045284 6:31290380-31290402 TCTGAGACAAATATGGATCCAGG + Intronic
1007429651 6:41769432-41769454 CTTGGCCCAGAGATGGATCCTGG - Intergenic
1008474932 6:51926329-51926351 CTTGAGGCACAGCTGAGTCCAGG - Intronic
1008483871 6:52014554-52014576 CTGGATAAACAGATGGATCATGG + Intronic
1009537793 6:64911929-64911951 CTTCAGATACGGCTGGATCCAGG + Intronic
1010905203 6:81478715-81478737 CTTAAGAAATAGATAGATCCTGG - Intergenic
1011005942 6:82645747-82645769 CTTGAGACACAATTGGACCAGGG - Intergenic
1012652390 6:101772048-101772070 CTTCAAACATAGCTGGATCCAGG + Intronic
1016401288 6:143683601-143683623 CCAGAGACACAGATGAATACAGG - Intronic
1018372208 6:163178474-163178496 CTTGAGACACAGACACATGCAGG + Intronic
1019356904 7:585007-585029 CTTCAGGCACGGCTGGATCCAGG - Intronic
1019516497 7:1442504-1442526 CATCAGGCACAGCTGGATCCAGG + Intronic
1020119777 7:5496465-5496487 CTTTAGCCACCTATGGATCCAGG - Intronic
1020264917 7:6553871-6553893 TTTCAGGCACAGCTGGATCCAGG - Intergenic
1022624436 7:32020093-32020115 CTTGAGAGCCTGAGGGATCCCGG - Intronic
1023909186 7:44541587-44541609 CTGGAGGCACAGATGGGACCAGG + Intergenic
1026671188 7:72392035-72392057 CAAGAGAAACAGATGGAACCCGG - Intronic
1027978375 7:85186515-85186537 CCTGAGACAGAGAAGGCTCCCGG - Intronic
1028364460 7:90011241-90011263 ATTCAGGCACAGCTGGATCCAGG - Intergenic
1029972606 7:104803951-104803973 CTTACGACACAGCTGGATTCAGG + Intronic
1030538861 7:110803809-110803831 GTTGAGATACTGATGGTTCCAGG - Intronic
1030871536 7:114762313-114762335 AGAGAGACACAGGTGGATCCTGG - Intergenic
1032422445 7:131793535-131793557 CAAGAGACACTGAAGGATCCTGG - Intergenic
1036049535 8:5180451-5180473 CTTGAGAGACAAATGCAACCGGG - Intergenic
1037399211 8:18476731-18476753 CTTCACACACAGGTGGAACCAGG - Intergenic
1038781718 8:30573880-30573902 CTTCAGACTCAGCTGGACCCAGG + Intergenic
1040496217 8:47967755-47967777 CTTGAGACACACACAGCTCCAGG - Intronic
1041224784 8:55687398-55687420 CTTGAGACACACAGGGTTCCTGG + Intergenic
1043875794 8:85484603-85484625 CAGCAGACACAGATGGAGCCAGG - Intergenic
1044716166 8:95101855-95101877 CTTCTGACCCAGCTGGATCCAGG + Intronic
1044871865 8:96627654-96627676 CTTCAGGCACAGCTGGATCTTGG + Intergenic
1045822127 8:106351528-106351550 GTGGAGACACAGATGCATTCGGG + Intronic
1046798139 8:118394734-118394756 CTTGAGACATAGTTGGATGATGG + Intronic
1047716522 8:127600604-127600626 TTTCAGGGACAGATGGATCCAGG + Intergenic
1047930271 8:129721638-129721660 CTTCAGACAGGGCTGGATCCAGG + Intergenic
1048491714 8:134900467-134900489 CTTCAGGCACAGCTAGATCCAGG + Intergenic
1049427976 8:142545721-142545743 CTGGAGACACAGAGGGAAGCAGG - Intergenic
1049701359 8:144014787-144014809 CGTGAGACACACATGGGTCAGGG - Intronic
1049817828 8:144616161-144616183 CTTGTCACACAGACGGAGCCAGG - Intergenic
1053290924 9:36879253-36879275 CTCAAGACACAGATGGCTGCAGG - Intronic
1057522353 9:95770087-95770109 CTTCAGGCACAGCTGGATCTAGG - Intergenic
1057891526 9:98873651-98873673 CTTCAGGCACAGCTGGATCCAGG + Intergenic
1058410258 9:104724096-104724118 CTTTAGACACAGCTGAATCGAGG - Intergenic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1060771858 9:126337746-126337768 TTTGAGATACAGATGGATGCTGG + Intronic
1061207280 9:129172145-129172167 CTTCAGGCACAGCAGGATCCAGG - Intergenic
1061297415 9:129684309-129684331 CTTCAGGCACTGCTGGATCCAGG + Intronic
1062614152 9:137388446-137388468 CTTGAGACACAGACGCACGCGGG + Intronic
1062633337 9:137477216-137477238 CTTGGAACAGAGATGGAGCCTGG - Intronic
1188413294 X:29900856-29900878 CTAGAGGCACTGATGGATACAGG + Intronic
1189985409 X:46549172-46549194 CTTGAGACACAGAGGGAAAAAGG - Intergenic
1194769063 X:97878073-97878095 CTTTAGACACAGATGCATTCAGG - Intergenic
1199370678 X:147043808-147043830 GCTGTGACACAGATGGACCCAGG - Intergenic
1200793682 Y:7321445-7321467 CTTGAGGCATAAAGGGATCCAGG - Intergenic