ID: 1110594139

View in Genome Browser
Species Human (GRCh38)
Location 13:77300124-77300146
Sequence AGCATTTTAGAGGATTTACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 227}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110594139_1110594141 13 Left 1110594139 13:77300124-77300146 CCTTGTAAATCCTCTAAAATGCT 0: 1
1: 0
2: 1
3: 24
4: 227
Right 1110594141 13:77300160-77300182 ATCCAAATTTACAGAACTTCTGG 0: 1
1: 0
2: 1
3: 13
4: 201
1110594139_1110594143 23 Left 1110594139 13:77300124-77300146 CCTTGTAAATCCTCTAAAATGCT 0: 1
1: 0
2: 1
3: 24
4: 227
Right 1110594143 13:77300170-77300192 ACAGAACTTCTGGAATAAAATGG 0: 1
1: 0
2: 2
3: 44
4: 385

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110594139 Original CRISPR AGCATTTTAGAGGATTTACA AGG (reversed) Intronic
903626483 1:24734320-24734342 AGCATTTAGGAGGATATCCATGG - Intergenic
905132361 1:35770315-35770337 AACTTTTTAGAGGAATTCCAAGG + Intergenic
906839793 1:49124504-49124526 AGCAACTTAGAGGCTTTACAAGG + Intronic
907690592 1:56660910-56660932 AGAACTTTAAAGGATTTTCAGGG + Intronic
908898938 1:68933307-68933329 AGACTTTTAGAGGATGTACCTGG - Intergenic
909566540 1:77059012-77059034 AGCTTTTTAGAAGATTCAAATGG - Intronic
909818948 1:80034103-80034125 AGCATTTTAAAGCATTTTAAGGG + Intergenic
910413036 1:86966282-86966304 AGCATATTGTAGTATTTACAGGG - Intronic
910949094 1:92626103-92626125 TGGTTTTTAGAGTATTTACAGGG + Intronic
912915929 1:113814395-113814417 AACATTTGGGAAGATTTACAAGG + Exonic
914932093 1:151944081-151944103 AGAATTTTGGAGGCTTAACAGGG - Intergenic
915812631 1:158930873-158930895 TGCATTTTCCAGGATTTTCAAGG + Intronic
915860868 1:159442729-159442751 GGCATTTTTCAGGATTAACAAGG + Intergenic
918224632 1:182470413-182470435 AGCATGTTTGAGGAATTGCAAGG - Intronic
918376574 1:183915281-183915303 AATATTTTATAGGATTAACATGG + Intronic
918907545 1:190516972-190516994 AACATTTGAAAGGATTTTCAAGG - Intergenic
919190173 1:194206128-194206150 ATCCTTTCAGAGGATTTGCAAGG + Intergenic
921262414 1:213395856-213395878 AACATTTCAGAGTAGTTACAAGG + Intergenic
921565800 1:216717422-216717444 AGCCTTTTGAAGGATTTACCTGG - Intronic
1064421991 10:15198483-15198505 AGCATTTTGGAGGATTTCTTTGG - Intergenic
1065453590 10:25883444-25883466 AGCCTTTTTGAGCATTCACATGG - Intergenic
1066154314 10:32658126-32658148 AGCAGTTTGGAGGACTTAGAAGG - Intronic
1068862039 10:61857034-61857056 ACCAATTTTGAGGATATACAAGG - Intergenic
1069388446 10:67906650-67906672 AGCATTTTAAAGTATCTAGATGG - Intronic
1070422363 10:76249715-76249737 AGCATTTTAGTCGATCTACCTGG - Intronic
1071696234 10:87875077-87875099 AACATTAGAGAGGATTTTCATGG + Intronic
1073319881 10:102608706-102608728 AGCGTTTTAGGGGATTTTCTTGG + Intronic
1075111381 10:119588159-119588181 ATCATTTTACAGCTTTTACAGGG + Exonic
1077960462 11:7071825-7071847 AGCATTTTTGAGAATTTCCCAGG + Intergenic
1079488125 11:20956913-20956935 AGCATTTTAGATGAACTAGAAGG - Intronic
1079616731 11:22503595-22503617 AGCATTTTAGAGGCTAAAAATGG + Intergenic
1080443982 11:32320707-32320729 AGAATTGAAGAGGATTTACATGG - Intergenic
1080885965 11:36368428-36368450 ATCATTTGAGAGGATTTTTAGGG + Intronic
1081287437 11:41288333-41288355 ACCGTTATAGAGGATCTACAAGG - Intronic
1081971395 11:47201327-47201349 AGGATTTGAGAGGTTTTCCATGG + Intergenic
1081971967 11:47205541-47205563 AGCATTTTATAAGATTTCCAAGG + Intergenic
1084281041 11:68094046-68094068 AGCATTTTAAATGTGTTACAAGG - Intronic
1085712272 11:78841020-78841042 AACATTTTTGAGGGCTTACAGGG - Intronic
1085817662 11:79757586-79757608 AGCATTTTAGAGGTGCTAGATGG + Intergenic
1086670559 11:89541105-89541127 AGAATTTAAGAGGATTTTGAGGG - Intergenic
1088053544 11:105548725-105548747 AGCTTATTAGAGAATTTGCATGG + Intergenic
1088556168 11:111063549-111063571 AGCATGTTTGAGAATTTAAATGG - Intergenic
1089992876 11:122878012-122878034 AGAATTTTAGAGGACTGAAATGG - Intergenic
1090235153 11:125141541-125141563 CGGCTTTTAGAGCATTTACAAGG - Intergenic
1090605139 11:128414669-128414691 AGCATTTTAGCAGACTTGCAAGG - Intergenic
1090632733 11:128664439-128664461 CACAGCTTAGAGGATTTACAAGG - Intergenic
1094349326 12:29506232-29506254 TGCTTTTTTGAGGAATTACAGGG - Intronic
1094731233 12:33178750-33178772 AGCATTTGAGTGCATTTTCAGGG + Intergenic
1099201209 12:79679297-79679319 AGCATATGAGAGGAGTGACAGGG + Intronic
1099723523 12:86395354-86395376 ACCATATTAGAGCATTCACAGGG + Intronic
1099749049 12:86747326-86747348 AGCTTGTTAGAGAATTTAAATGG + Intronic
1107138799 13:36975403-36975425 ACCAGTTTAGAGGAAGTACAGGG - Intronic
1107147950 13:37079769-37079791 AGCATTTGAGAGGATGTACAAGG + Intergenic
1108735849 13:53282518-53282540 AACATTTTTGAGTATCTACATGG - Intergenic
1108821150 13:54351719-54351741 AGCCTTTTAGTGGGTTTATAGGG - Intergenic
1110594139 13:77300124-77300146 AGCATTTTAGAGGATTTACAAGG - Intronic
1110883529 13:80603355-80603377 AGAATTTGAGATGATGTACAAGG + Intergenic
1111275703 13:85943754-85943776 AGAGTTTTAGAGGATGTACTTGG + Intergenic
1111725477 13:92002942-92002964 AGCATTTAAGAACATTTAAATGG + Intronic
1112046387 13:95602202-95602224 AGCAGTTTAGAGTAATTACTTGG - Intronic
1112155628 13:96813764-96813786 ATCATTTGTGAGTATTTACAGGG - Intronic
1113056515 13:106273850-106273872 AGCATTTTACATCAGTTACAAGG + Intergenic
1113242765 13:108357710-108357732 TTCATTTTAAAGGTTTTACATGG - Intergenic
1116307430 14:43275825-43275847 TGCATTTTAAAGCATTTTCATGG + Intergenic
1116708369 14:48332599-48332621 ATCATTTAAGAGGATTTAAAAGG - Intergenic
1117332919 14:54731541-54731563 AGCAATTTAGGGGTTTTAAAAGG - Intronic
1118238631 14:64036067-64036089 AGCCTCTTAAAGGATTTAAAAGG - Intronic
1118862923 14:69679198-69679220 ATCCTTTTAGGGGATTGACAGGG + Intronic
1119742426 14:77022870-77022892 AGCATCTTAGAGGATCTTCCAGG + Intergenic
1122510462 14:102262735-102262757 AGCATCATAGATGATTTAGATGG - Intronic
1125194084 15:37026668-37026690 AGCATTATAGAAAATTAACATGG - Intronic
1125481655 15:40085243-40085265 GGCATTTTAAAGGATTTTCAAGG - Intergenic
1127362164 15:58253562-58253584 AGCCTCTTAGGAGATTTACAGGG - Intronic
1127673667 15:61219943-61219965 AGCATTCTTGAGGACTCACAGGG - Intronic
1128528378 15:68427973-68427995 ACCATATTAGAGGATTTTTAAGG + Intronic
1129830975 15:78669928-78669950 GCCTTTTTAGAGGATCTACAAGG + Intronic
1129900284 15:79143000-79143022 AGAATTTTAAAGGAGTTAGATGG + Intergenic
1130345688 15:83042784-83042806 AGTATCTTAGATGATATACATGG + Intronic
1132528411 16:429871-429893 AGCATTTTAAATTATTTAAATGG + Intronic
1133309368 16:4833874-4833896 ATAATTTTATAGGCTTTACAAGG + Intronic
1134353032 16:13455737-13455759 AGCTTTTTAGTGGATCTAAAAGG + Intergenic
1135515459 16:23128849-23128871 ACCATTTTACAGGAAATACATGG + Intronic
1137286572 16:47021138-47021160 ACCATTTGAGAGGAATAACATGG + Intergenic
1137524510 16:49222847-49222869 ACCATTTCACAGGATTTACCTGG - Intergenic
1138824915 16:60307528-60307550 AGCCTTTAAGAGAATCTACAAGG - Intergenic
1139279343 16:65756490-65756512 AACATTTTAGAGGTTTTATTAGG + Intergenic
1139836026 16:69839219-69839241 AGCCTTTATGAGGATTTCCACGG - Intronic
1140318375 16:73922115-73922137 AACATCTGAGAGGATTTAAAGGG + Intergenic
1143625223 17:8106042-8106064 AGTATTTCAGAGGATTAGCAGGG + Intronic
1147022106 17:37543756-37543778 AGCATTTTAGTGGTGTTACTAGG + Intronic
1148289858 17:46435569-46435591 AGAATCTAAGAGGATCTACATGG - Intergenic
1148312026 17:46653141-46653163 AGAATCTAAGAGGATCTACATGG - Intronic
1150960756 17:69909883-69909905 AGAATTTTAACGGATGTACAAGG - Intergenic
1152053967 17:78007198-78007220 AGTATTTTAGAGGATATAGAAGG - Intronic
1153063891 18:1023262-1023284 CTCATTTTACAGGATTTTCAAGG - Intergenic
1153128176 18:1821715-1821737 AGCATTTTTGAGCATCAACATGG - Intergenic
1153231376 18:2939797-2939819 AGTATTTAAGAGGACTTACCAGG + Intronic
1155106265 18:22669277-22669299 AGCCTCATAGAGGCTTTACAAGG + Intergenic
1158230940 18:55254325-55254347 AGTGTTTTAGTGTATTTACAAGG - Intronic
1160125014 18:76163763-76163785 AGCATTTAAAATTATTTACATGG + Intergenic
1167802507 19:51753849-51753871 TGCATTTTAGAAGATTCCCAAGG + Intronic
1167806280 19:51788367-51788389 AGCATTTTAGAAGATTCCCAAGG + Intronic
925836672 2:7953180-7953202 AGCATTAAAGAGAATTTAAAGGG - Intergenic
926948894 2:18219944-18219966 AGAATTTGGGAGGATTTTCAAGG + Intronic
928104106 2:28456639-28456661 AGCATCTTAGAGTAGTTTCACGG + Intergenic
928547398 2:32341340-32341362 AGCATTTTGAAGGATGTACTGGG - Intergenic
928898940 2:36297201-36297223 AGGATTTTAGAGGATGAACAAGG - Intergenic
929078389 2:38097308-38097330 AGAATTTTAAAAGATTTGCATGG - Intronic
929707696 2:44232346-44232368 AGCATTTTAGAAGGTTTTTAAGG - Intronic
929813468 2:45212036-45212058 AGCAATTTACAGGAAATACAGGG - Intergenic
929972417 2:46594180-46594202 AGCAATTTAAAGGATTTCCTAGG + Intronic
931228986 2:60358294-60358316 AACATTTTACAGGAAATACACGG + Intergenic
931310725 2:61077404-61077426 ACCCTTTTAGAGGGTCTACAAGG + Intronic
937060245 2:118975344-118975366 GGCAGATGAGAGGATTTACAAGG + Intronic
939170157 2:138686425-138686447 TGCATTTTAGAAAATTTACTGGG - Intronic
939326950 2:140704060-140704082 AGCAGTTTGGAGATTTTACAAGG - Intronic
940596680 2:155802942-155802964 ACCATTTTAAAGAATTTACTGGG - Intergenic
940723266 2:157305146-157305168 AGGTTTTTAATGGATTTACAGGG - Intronic
942325001 2:174769066-174769088 GGCATTTAAGATGATTTGCAGGG + Intergenic
942639369 2:178045230-178045252 AACATTTTAGAGAGTTTTCAAGG - Intronic
942756236 2:179344546-179344568 ATCATTTTCCAGGATTTAAAAGG - Intergenic
943011055 2:182449982-182450004 AGCATTATAAATGCTTTACATGG - Intronic
943257265 2:185611848-185611870 TACAGTTTATAGGATTTACAAGG - Intergenic
943508849 2:188799443-188799465 AGCACTTTACAGGAAATACAAGG + Intergenic
943781892 2:191833431-191833453 AGAATTTTAGAGTTATTACATGG - Intergenic
944015103 2:195026558-195026580 ATCATTTTCTAGGAGTTACATGG + Intergenic
944031378 2:195238897-195238919 AACATTTCAGAGGTTTTAGAAGG - Intergenic
944408724 2:199415405-199415427 AGCACTTTAAATGATTTATATGG - Intronic
945344362 2:208695436-208695458 AGCGTTTTAGAGTCTTTGCATGG - Intronic
945757953 2:213873313-213873335 AGAATTATAAAGGATTTATAAGG - Intronic
947093505 2:226540517-226540539 AGCATTTTAAAAGATTGATATGG - Intergenic
947707728 2:232290148-232290170 AGAATTTTTGAGGATTTTCATGG - Intronic
947895855 2:233671357-233671379 AGCATTTTAGAGGCTTCTCAGGG + Intronic
1169680843 20:8211429-8211451 ACCATTTTAGACCATTTACATGG + Intronic
1169693640 20:8361755-8361777 AACATTTTAGATGATTCAAAGGG + Intronic
1173064069 20:39692570-39692592 AGCATTTTAGAAAATGAACAAGG + Intergenic
1173898252 20:46567306-46567328 ACCATTATTGAGGCTTTACAGGG + Intronic
1173898608 20:46569950-46569972 AGCCTTTTAAAAGATTTTCAAGG - Intronic
1175340357 20:58225409-58225431 AGCATTTTTGAGGCTTTATTTGG - Intronic
1175430358 20:58897738-58897760 AGCCTGTGAGAGGGTTTACAGGG + Intronic
1177199737 21:17940991-17941013 AGAATTTAAGAGAATTTTCAAGG + Intronic
1180126504 21:45794216-45794238 ACCATTGTAAATGATTTACAAGG + Intronic
1184626660 22:45738278-45738300 AGCATTTTACAGGATTTCTGTGG + Intronic
950847571 3:16029788-16029810 AGCATTTTAAAAGATGTACCAGG - Intergenic
951073249 3:18358005-18358027 AGCATTTTAAATTATTTACTAGG + Intronic
954926239 3:54237514-54237536 AGCATTTTTATAGATTTACACGG + Intronic
955046281 3:55363415-55363437 AGCATTTCAGAGGAAATAGAAGG - Intergenic
955196143 3:56806482-56806504 AGCATTTTATAGGATTATAACGG - Intronic
955200386 3:56846799-56846821 AGCATTTTAGAGCTTTGACAGGG - Intronic
955588091 3:60503818-60503840 AACATTTTAAAAGATTAACAGGG + Intronic
955898331 3:63724986-63725008 ATCAATTGATAGGATTTACAAGG - Intergenic
957245217 3:77707861-77707883 AGCATTCAGGAGGATCTACAGGG - Intergenic
960451962 3:117820974-117820996 AGCATTTCAGACGAATTACTGGG + Intergenic
960514011 3:118582875-118582897 AGCATTGTGGAGGGGTTACATGG - Intergenic
961736845 3:129007327-129007349 TGCATTCTAGAGGAATTACCGGG + Intronic
962682156 3:137811412-137811434 AGCATTATAAAGGCTTTTCATGG + Intergenic
963017582 3:140840532-140840554 AGCATTTTGGATTATCTACAGGG - Intergenic
963488755 3:145971986-145972008 AACATTTTACAGGTTTTCCAGGG + Intergenic
965261647 3:166493744-166493766 AAGATTATAGAGGAATTACAGGG - Intergenic
966714991 3:183005875-183005897 AGCATGTTAGATGACTGACATGG + Intergenic
966771586 3:183508966-183508988 AGCAATTTACAGGAAATACAGGG + Intronic
968373883 4:21358-21380 AGCATTTTAGAGAATGAACCAGG - Intergenic
971616737 4:28800177-28800199 AGCATATAAGTGGATTTCCAAGG - Intergenic
973895830 4:55411989-55412011 ATTATTTTAGAGGATACACAAGG - Intronic
973997535 4:56474365-56474387 AGCTTTTTGTAGGATTTTCATGG - Exonic
976508144 4:85873476-85873498 TGCAGTGCAGAGGATTTACAAGG + Intronic
977787983 4:101062351-101062373 ATCATTTTAGGGCATTTAAAGGG + Intronic
980255844 4:130380297-130380319 AGCATTTAAAAGGATATATATGG - Intergenic
980267552 4:130537757-130537779 ATCATTTTTGATGATTTATAGGG + Intergenic
980478846 4:133358185-133358207 GGCATGTTGGAGGATTAACAAGG - Intergenic
980662344 4:135878812-135878834 AACTTATTTGAGGATTTACATGG + Intergenic
982570531 4:157045341-157045363 AGCATCTTCGAGGTTTTAGATGG + Intergenic
982741106 4:159058104-159058126 AGCATTTTAGGAGATCTACACGG - Intergenic
982833465 4:160092188-160092210 AGCATGATCGAGGATTTATATGG + Intergenic
983221997 4:165052776-165052798 AGCATTTCAGAGGAGTATCAGGG - Intergenic
983294213 4:165845228-165845250 AACATTTTAGAAATTTTACAAGG + Intergenic
983744725 4:171183668-171183690 AGCATTGTATAGGTTTTTCATGG + Intergenic
984406196 4:179333829-179333851 TCCATTTCATAGGATTTACATGG - Intergenic
984936470 4:184894222-184894244 AGAATGTTAGAGCATTCACAAGG - Intergenic
985460847 4:190104910-190104932 AGCATTTTAGAGAATGAACCAGG + Intergenic
989010891 5:36871597-36871619 AGGATTTTAGAGGAAGTACCAGG - Intergenic
989564624 5:42889760-42889782 AGCATATGAGAGGATCTGCATGG + Intergenic
992479849 5:77139852-77139874 TACATTTTAAATGATTTACAAGG - Intergenic
994411583 5:99413072-99413094 AGCACTTTAGATGATTAACTTGG + Intergenic
994482243 5:100352178-100352200 AGCACTTTAGATGATTAACTTGG - Intergenic
994515914 5:100772814-100772836 AGGATTTGAGAGGATTTATGTGG + Intergenic
995389149 5:111620495-111620517 AGAAATTTAGAGGAGTTACTAGG + Intergenic
995767748 5:115637367-115637389 AGAATTTCAGAAGATTTTCAGGG + Intergenic
996134420 5:119821761-119821783 ATCATTTCAAAAGATTTACAAGG - Intergenic
996164419 5:120207389-120207411 AGCATTTTAGATGTTTTGCTTGG + Intergenic
998920611 5:147063782-147063804 AGAATGTTAGAGGATTTGAAAGG + Intronic
999330230 5:150668813-150668835 AGCTATTTAGAGGATTTTCAGGG - Intronic
1000141314 5:158405879-158405901 TGCATTTTTAATGATTTACAAGG + Intergenic
1000168913 5:158682312-158682334 AGTCTTTTAGATCATTTACATGG - Intergenic
1000398993 5:160805658-160805680 GGCACTTAAGAGCATTTACACGG + Intronic
1003069442 6:2933424-2933446 AGCATCTTATAGTTTTTACATGG - Intergenic
1003893711 6:10586603-10586625 AGCATCTGAAAGGATTTAAAGGG + Intronic
1004814525 6:19298346-19298368 AGCGGTTTAGAGGATTAAAAAGG + Intergenic
1008138041 6:47799863-47799885 AGAAATTTAGAGGATGTACATGG - Intronic
1008446858 6:51602171-51602193 AGCATTTTGAAGGAGTAACAAGG + Intergenic
1008558917 6:52704345-52704367 AGCATTCAAGAGGATTTTCAAGG + Intergenic
1008781779 6:55115570-55115592 AGCATTTTAGAGAATATTCCTGG - Intronic
1010995955 6:82532805-82532827 AGAAATTCAGAGAATTTACATGG + Intergenic
1012278435 6:97300663-97300685 AGCATTTTCAAGGAATGACAGGG + Intergenic
1012540060 6:100352133-100352155 AGGATTTTAAAGGATTTGCAGGG + Intergenic
1012763629 6:103334809-103334831 AGCATTTAAGAAGAAATACAGGG + Intergenic
1013323516 6:109020645-109020667 AGGTTTTCAGAGGATTTAGAAGG + Intronic
1015294407 6:131574374-131574396 AGACTTTTGGAGGATTTCCAGGG - Intronic
1020734048 7:11924094-11924116 AGCATTTCAGAAAATTGACATGG + Intergenic
1021638408 7:22714004-22714026 AGAATCTCAGAGGATTTAAACGG + Intergenic
1021801562 7:24311764-24311786 AGCATGGAAGAGGAATTACAGGG + Intergenic
1023244102 7:38181941-38181963 AGCATTTGAGTGGACTTAGAGGG - Intronic
1027398806 7:77786466-77786488 AGGGTTTTATAGGCTTTACAGGG + Intergenic
1030782110 7:113614096-113614118 ACCATTTTACAGTATATACAGGG + Intergenic
1031674964 7:124598661-124598683 ATCATTCTAGTGGTTTTACATGG - Intergenic
1032348236 7:131136635-131136657 AGCATTTTTGGGGATGTCCAGGG + Intronic
1033175275 7:139117996-139118018 TTCATTTTAGAGGATTGACAGGG + Intergenic
1033674236 7:143521905-143521927 AGCATTGTAGAATATTTACATGG + Intergenic
1033687012 7:143650081-143650103 AGCATTGTAGAATATTTACATGG + Intronic
1033697599 7:143807542-143807564 AGCATTGTAGAATATTTACATGG - Intergenic
1036535427 8:9645547-9645569 AGGATTTTAAAAGATTTGCAGGG + Intronic
1037070341 8:14638593-14638615 AACCTTTAAGAGGATTTACTGGG - Intronic
1038468344 8:27787831-27787853 ACAATTTTGGAGGAATTACAAGG - Intronic
1038608708 8:29038572-29038594 AGCATTTTAGATTATTTTGAAGG - Intronic
1038661653 8:29502729-29502751 AGCATTCAAGAGGACTTATAGGG - Intergenic
1042502163 8:69521424-69521446 AGTGTTAAAGAGGATTTACAAGG + Intronic
1043028400 8:75100732-75100754 AGCTTTTTAAATGATTTTCAGGG + Intergenic
1043247109 8:78017977-78017999 AGGATTTTAGTGTATTTACAAGG - Intergenic
1043931090 8:86092482-86092504 ACCAATTTATAGGAATTACAGGG + Intronic
1044479709 8:92671194-92671216 AGCATATGAGAGGAATTACAAGG - Intergenic
1045557645 8:103230403-103230425 GGCTTTTTGGAGGATTCACAGGG - Intergenic
1045917778 8:107493038-107493060 AGCATCTTAAAGTAGTTACAAGG + Intronic
1046042144 8:108918672-108918694 GGAATTTTAGAGGATTTCAAAGG - Intergenic
1048654475 8:136520499-136520521 AGCATTTTTGGGGTTTTAAAAGG + Intergenic
1051868767 9:21712910-21712932 AGAGTTGTAGAAGATTTACATGG + Intergenic
1054814738 9:69464266-69464288 AGCATTTTAATGGATGTAAAAGG + Intronic
1056251011 9:84748075-84748097 AGCATTTTGTTGGATTTGCAGGG + Intronic
1057500642 9:95594522-95594544 AGCACTTGGGAGGGTTTACAAGG - Intergenic
1058317692 9:103588475-103588497 AGCATTTGAAAGGCTATACAGGG - Intergenic
1059142502 9:111866929-111866951 ATCATTTTAAAGGATTTCCTGGG + Intergenic
1060673918 9:125495152-125495174 GGCATTTTTGACAATTTACATGG + Intronic
1060725705 9:126004470-126004492 ATAATTTTAAAGTATTTACATGG - Intergenic
1186954452 X:14666658-14666680 AACATGTTTGAGCATTTACAAGG + Intronic
1188066845 X:25672446-25672468 AGTATTTTAAAGGAGTAACATGG - Intergenic
1188103615 X:26121371-26121393 AGCATTTTATAGGAGTTCCATGG - Intergenic
1188828505 X:34866980-34867002 AGCATTTTTGAAGATATTCAAGG - Intergenic
1190791197 X:53701902-53701924 TGCATTTTAGATGAGTTTCAAGG + Intergenic
1193603323 X:83535618-83535640 AGCAGTTGAGAGTGTTTACATGG + Intergenic
1196627499 X:117893360-117893382 ACCATTTCAGAGGGTTCACAAGG - Intergenic
1196964381 X:121039728-121039750 AGCATTTTATAGGTTTATCAGGG + Intergenic
1197209045 X:123814420-123814442 TGCATTTTAAATGGTTTACATGG + Intergenic
1199999486 X:153050678-153050700 AGCAGTGTAGAGGAGGTACATGG + Intergenic
1201265036 Y:12198180-12198202 TGCATTTTTGAGGAAGTACAGGG - Intergenic