ID: 1110596556

View in Genome Browser
Species Human (GRCh38)
Location 13:77326662-77326684
Sequence GAACAGCGCCCCCGGCGCCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 105}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110596545_1110596556 12 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1110596545 13:77326627-77326649 CCCGCAGCAGCCACGGAGCCGTC 0: 1
1: 0
2: 1
3: 13
4: 173
Right 1110596556 13:77326662-77326684 GAACAGCGCCCCCGGCGCCGGGG 0: 1
1: 0
2: 1
3: 9
4: 105
1110596543_1110596556 17 Left 1110596543 13:77326622-77326644 CCAGCCCCGCAGCAGCCACGGAG 0: 1
1: 0
2: 5
3: 30
4: 337
Right 1110596556 13:77326662-77326684 GAACAGCGCCCCCGGCGCCGGGG 0: 1
1: 0
2: 1
3: 9
4: 105
1110596537_1110596556 25 Left 1110596537 13:77326614-77326636 CCCCAGCCCCAGCCCCGCAGCAG 0: 1
1: 1
2: 21
3: 182
4: 1368
Right 1110596556 13:77326662-77326684 GAACAGCGCCCCCGGCGCCGGGG 0: 1
1: 0
2: 1
3: 9
4: 105
1110596542_1110596556 18 Left 1110596542 13:77326621-77326643 CCCAGCCCCGCAGCAGCCACGGA 0: 1
1: 0
2: 0
3: 17
4: 266
Right 1110596556 13:77326662-77326684 GAACAGCGCCCCCGGCGCCGGGG 0: 1
1: 0
2: 1
3: 9
4: 105
1110596539_1110596556 23 Left 1110596539 13:77326616-77326638 CCAGCCCCAGCCCCGCAGCAGCC 0: 1
1: 1
2: 22
3: 264
4: 3156
Right 1110596556 13:77326662-77326684 GAACAGCGCCCCCGGCGCCGGGG 0: 1
1: 0
2: 1
3: 9
4: 105
1110596551_1110596556 -6 Left 1110596551 13:77326645-77326667 CCGTCGGGAACCGGCATGAACAG 0: 1
1: 0
2: 0
3: 1
4: 39
Right 1110596556 13:77326662-77326684 GAACAGCGCCCCCGGCGCCGGGG 0: 1
1: 0
2: 1
3: 9
4: 105
1110596538_1110596556 24 Left 1110596538 13:77326615-77326637 CCCAGCCCCAGCCCCGCAGCAGC 0: 1
1: 1
2: 20
3: 140
4: 1031
Right 1110596556 13:77326662-77326684 GAACAGCGCCCCCGGCGCCGGGG 0: 1
1: 0
2: 1
3: 9
4: 105
1110596540_1110596556 19 Left 1110596540 13:77326620-77326642 CCCCAGCCCCGCAGCAGCCACGG 0: 1
1: 3
2: 2
3: 55
4: 518
Right 1110596556 13:77326662-77326684 GAACAGCGCCCCCGGCGCCGGGG 0: 1
1: 0
2: 1
3: 9
4: 105
1110596544_1110596556 13 Left 1110596544 13:77326626-77326648 CCCCGCAGCAGCCACGGAGCCGT 0: 1
1: 0
2: 0
3: 14
4: 96
Right 1110596556 13:77326662-77326684 GAACAGCGCCCCCGGCGCCGGGG 0: 1
1: 0
2: 1
3: 9
4: 105
1110596546_1110596556 11 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1110596546 13:77326628-77326650 CCGCAGCAGCCACGGAGCCGTCG 0: 1
1: 0
2: 0
3: 8
4: 133
Right 1110596556 13:77326662-77326684 GAACAGCGCCCCCGGCGCCGGGG 0: 1
1: 0
2: 1
3: 9
4: 105
1110596550_1110596556 2 Left 1110596550 13:77326637-77326659 CCACGGAGCCGTCGGGAACCGGC 0: 1
1: 0
2: 0
3: 5
4: 68
Right 1110596556 13:77326662-77326684 GAACAGCGCCCCCGGCGCCGGGG 0: 1
1: 0
2: 1
3: 9
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110596556 Original CRISPR GAACAGCGCCCCCGGCGCCG GGG Exonic
900283911 1:1890494-1890516 GACCCGCGCCCCCGGGGCCCCGG + Intronic
900305288 1:2003792-2003814 AAACCACGCCGCCGGCGCCGCGG - Exonic
903438310 1:23368894-23368916 CAACAGCGCCTGCGGCGGCGCGG + Intronic
903884288 1:26531904-26531926 GAACAGCCCAACCTGCGCCGTGG - Intronic
905347937 1:37324054-37324076 GAAAAGGGGACCCGGCGCCGTGG + Intergenic
906637078 1:47416845-47416867 GAGCGGCGGCCCTGGCGCCGCGG - Exonic
906960885 1:50419004-50419026 GCCCAGCGCCCCAGGCGCCATGG + Exonic
907213564 1:52843171-52843193 GAAAAGCACCCCCCGCTCCGCGG - Intronic
908401150 1:63774095-63774117 GAACAGCGCACCCTGCGCCCAGG - Exonic
910237221 1:85048331-85048353 GAACGGCGCCCGCGGCGCACAGG - Intronic
917846727 1:179026130-179026152 GACCCCCGCCCCCGGCGCGGCGG + Intronic
918064220 1:181088869-181088891 GCACAGGGCCGTCGGCGCCGGGG - Exonic
919828608 1:201522168-201522190 GCACTGCGCCCCCGGCCCTGTGG + Intergenic
920260538 1:204685270-204685292 GGGCAGCGCCGCCGCCGCCGGGG - Intronic
922486266 1:225975618-225975640 GAACAGGGCGCCGGGCGCGGTGG + Intergenic
1067682755 10:48450890-48450912 GAACAGCCCCCACGGGGCCGGGG - Exonic
1075031830 10:119029401-119029423 GAGCGGCGCCCGAGGCGCCGGGG + Intergenic
1075033456 10:119042698-119042720 GAAGAGCGGCCCCGGCGTCTGGG - Exonic
1076374206 10:129972743-129972765 GAGGAGCGCACCCGGCTCCGGGG + Intergenic
1083933859 11:65860365-65860387 GGACAGCGCCCCCTGTGACGGGG - Intronic
1084539096 11:69775425-69775447 CCACAGCGCCCCGGGCGCCCAGG - Intergenic
1103188630 12:118981844-118981866 GGACAGCGCCCCGGACGCCCCGG + Exonic
1103921987 12:124403972-124403994 GAACAGACCCCCCGGCCCCCAGG + Intronic
1105704966 13:22962929-22962951 GAACAGGGCTCCTGGCTCCGTGG + Intergenic
1105857925 13:24388113-24388135 GAACAGGGCTCCTGGCTCCGTGG + Intergenic
1108314094 13:49221008-49221030 GAACAGCGCCGCGGCCTCCGCGG - Exonic
1110497898 13:76190412-76190434 GAACACCACCCCCTGCTCCGCGG + Intergenic
1110596556 13:77326662-77326684 GAACAGCGCCCCCGGCGCCGGGG + Exonic
1111220941 13:85205181-85205203 GCCCAGCGCCCCCCGCCCCGTGG + Intergenic
1112771733 13:102800262-102800284 CAACAGCGTCCCCGGGGCCCGGG + Intronic
1115119874 14:29927191-29927213 GGGCAGCGCCCCCTGCGCCGCGG + Intronic
1118971672 14:70642543-70642565 GCGCCGCGCCCCCCGCGCCGCGG + Intronic
1122544963 14:102517109-102517131 GAACCCCGCCCCCGGGGCCAGGG - Intergenic
1124387984 15:29225694-29225716 GAACAACGCCCACGGAACCGGGG + Intronic
1124615176 15:31236481-31236503 GAACAGCCCCCTCGGCCCCCTGG - Intergenic
1125462412 15:39919960-39919982 GCACAACGCGTCCGGCGCCGAGG - Exonic
1126134556 15:45378082-45378104 GGGCGGCGCCCCCTGCGCCGTGG + Intronic
1126997570 15:54462554-54462576 GGCCAGTGCCCCCGGCCCCGGGG + Intronic
1127997760 15:64163334-64163356 GAACAGCGCTCCGGGCGGGGCGG - Intergenic
1128732983 15:70033635-70033657 GCCCAGCGCCCCAGGCGCGGGGG + Intergenic
1129541141 15:76347459-76347481 GATCGGCGCCCCCGCCACCGCGG - Intergenic
1132365126 15:101251565-101251587 GGGCAGCGCCGCCGCCGCCGCGG + Exonic
1132618637 16:854285-854307 GATCAGAGCCCCTGGCGCCTGGG + Exonic
1132691131 16:1182431-1182453 GAGCACCGCCCCCAGCGCAGGGG - Intronic
1132841158 16:1979104-1979126 GAGCGGCGCCCACGGCGCCAGGG - Exonic
1133021230 16:2967830-2967852 GAAAAGGGCCCCCGGCGCTGGGG + Exonic
1135992497 16:27226659-27226681 GTACAGAGCCCCGGGAGCCGAGG + Intronic
1140927621 16:79599293-79599315 GGCCGGCGCGCCCGGCGCCGCGG - Exonic
1141456370 16:84145057-84145079 GTACCGCGCCCCCCGCGCCCTGG - Intronic
1143099879 17:4499111-4499133 GAGCGGCGGCGCCGGCGCCGGGG + Exonic
1144339746 17:14301685-14301707 GAGCAGCAGCCCCGGCGCGGCGG - Exonic
1145886303 17:28384654-28384676 CAAAAGCGACCCTGGCGCCGCGG - Intronic
1146793199 17:35764475-35764497 GCACAGCCCCCGCGGCGCGGCGG - Exonic
1147193231 17:38748911-38748933 GGCCAGCGCCCCTGCCGCCGAGG - Intronic
1154173459 18:12067282-12067304 GAAGAGCTCCCCCGGCGCCGTGG - Intergenic
1160256237 18:77250607-77250629 GAACAGCGGCCCGGGCTCCGGGG - Exonic
1160725489 19:616288-616310 TCACGGCGCCCCCGGCCCCGCGG + Exonic
1160875802 19:1295754-1295776 GAGCGGCCCCCCGGGCGCCGCGG - Exonic
1160904642 19:1446414-1446436 GAACAGCGGGCGCGGCGGCGGGG + Intronic
1160991603 19:1862583-1862605 GAACCGCGTCGCCGCCGCCGGGG - Intronic
1161006765 19:1941103-1941125 GGCGCGCGCCCCCGGCGCCGTGG + Intergenic
1161115580 19:2494919-2494941 GAATCCCGGCCCCGGCGCCGGGG - Intergenic
1162145589 19:8610905-8610927 GACCAGCGCCCCCGCCGCGTGGG + Intergenic
1163026977 19:14518223-14518245 GAACAAGGAGCCCGGCGCCGAGG - Exonic
1165015839 19:32879482-32879504 GAACAGAGCCCTCGGTGCCTGGG + Intronic
1166275471 19:41750510-41750532 GAACACCGCCCCTGGAGCAGTGG - Intronic
1166396247 19:42443473-42443495 GAACACCGCCCCTGGAGCAGTGG + Intergenic
927567190 2:24123485-24123507 GCACTCCGCCCCCTGCGCCGCGG - Exonic
928166284 2:28974585-28974607 GAACAGAGCCCCAGGGACCGTGG - Intronic
929107248 2:38377173-38377195 GACCAGCGACCCAAGCGCCGCGG - Exonic
931719442 2:65056569-65056591 GGCCACCGCCCCCAGCGCCGCGG - Intronic
937990059 2:127657211-127657233 GAACAGCACCCCAGGTGCCCTGG - Intronic
940775069 2:157876273-157876295 GAAAAGTTCCCCCTGCGCCGAGG + Intergenic
943786344 2:191882079-191882101 GAACAAGGAGCCCGGCGCCGAGG - Intergenic
945088715 2:206159346-206159368 GAACAGCCTCCGCGGCTCCGGGG - Intronic
946246567 2:218391251-218391273 GAACAACGCCACCGTGGCCGTGG + Exonic
947538537 2:230957546-230957568 GCCCAGCACCGCCGGCGCCGCGG - Intronic
1169059559 20:2652121-2652143 GCACCGCCCACCCGGCGCCGGGG + Intergenic
1169171712 20:3470876-3470898 GAAGATCGCCTCCGGCGCCGCGG + Intergenic
1174287415 20:49482936-49482958 GGACAGCGCCCCGGGCGGCTGGG - Intergenic
1175887913 20:62302819-62302841 GAAAAGAGCCGCCGGCGCGGGGG + Intronic
1176059611 20:63166758-63166780 GAACGGAGCCCCGGACGCCGAGG + Intergenic
1176550033 21:8217047-8217069 GGACCGTGCCCCCGCCGCCGGGG - Intergenic
1176568960 21:8400082-8400104 GGACCGTGCCCCCGCCGCCGGGG - Intergenic
1176576874 21:8444317-8444339 GGACCGTGCCCCCGCCGCCGGGG - Intergenic
1180733872 22:18001415-18001437 CCACAGCGACGCCGGCGCCGAGG - Intronic
1181471344 22:23142036-23142058 CAGCAGCGTCCGCGGCGCCGCGG + Exonic
1184430739 22:44440423-44440445 GAACATCGCCCCAGGCCCTGGGG - Intergenic
1184890436 22:47375784-47375806 AAGCAGCGCCCCCGGCCCCTCGG - Intergenic
1203254923 22_KI270733v1_random:133373-133395 GGACCGTGCCCCCGCCGCCGGGG - Intergenic
1203262979 22_KI270733v1_random:178452-178474 GGACCGTGCCCCCGCCGCCGGGG - Intergenic
960120872 3:113947885-113947907 GTGCCCCGCCCCCGGCGCCGGGG - Exonic
965668568 3:171122247-171122269 GAACAGAGCCCCCGGGGGCAGGG + Intronic
970456350 4:16226993-16227015 GAGCCGGGCCCCCGCCGCCGCGG - Intronic
972890514 4:43551535-43551557 GAGCACCGCCCCCTGCTCCGCGG + Intergenic
974696835 4:65387256-65387278 GGACAGCGCCCCCAGCTCCAAGG - Intronic
978072626 4:104491565-104491587 CAGCAGCGCCGCCGCCGCCGCGG - Exonic
978529946 4:109703094-109703116 GAGTAGCGACGCCGGCGCCGGGG - Intronic
997965383 5:138352575-138352597 GCACAGCGCCCCCCGCGCTCTGG - Exonic
999753380 5:154646914-154646936 GCACAGCGGCCCCCGCCCCGTGG + Intergenic
1002052271 5:176577759-176577781 GCACAGCGCCACCGGCTCTGTGG + Exonic
1016383737 6:143511671-143511693 GAACAGCGCTCCCGAGGCCGCGG - Exonic
1017163856 6:151390528-151390550 CACCCCCGCCCCCGGCGCCGGGG - Intronic
1019335392 7:480321-480343 GAACAGCGCCCCTGCCCCCCAGG - Intergenic
1034439816 7:151080907-151080929 GAAGTGCGCGCCCGGCGCCGAGG + Intergenic
1037281464 8:17246903-17246925 GGAGAGCGCCCCCGGGGGCGGGG + Exonic
1038883612 8:31640103-31640125 GGACCGCGGCCCTGGCGCCGGGG + Intronic
1049018751 8:139939643-139939665 GCACAGAGCCCCCAGCGACGGGG - Intronic
1049389613 8:142360997-142361019 GAACAGCGTTCCCCGGGCCGGGG + Intronic
1049944465 9:580808-580830 GAGCACCGCCCCCTGCTCCGCGG - Intronic
1055091230 9:72365812-72365834 GAACAGCGCCGCCGGGGCATTGG - Intergenic
1059105151 9:111504693-111504715 AAACAGCTGGCCCGGCGCCGTGG + Intergenic
1062047057 9:134429199-134429221 GAACAGCGCCCACAGCGCAGGGG + Exonic
1203471325 Un_GL000220v1:116519-116541 GGACCGTGCCCCCGCCGCCGGGG - Intergenic
1203479146 Un_GL000220v1:160491-160513 GGACCGTGCCCCCGCCGCCGGGG - Intergenic
1202048361 Y:20756369-20756391 CAACAGCACCACCGGCGCCCAGG - Intronic