ID: 1110596881

View in Genome Browser
Species Human (GRCh38)
Location 13:77329150-77329172
Sequence GAAGCGAAATTAATGAATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 117}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110596881_1110596887 26 Left 1110596881 13:77329150-77329172 CCACCATTCATTAATTTCGCTTC 0: 1
1: 0
2: 1
3: 15
4: 117
Right 1110596887 13:77329199-77329221 CAGGCCCCTACGGAGCCTGATGG 0: 1
1: 0
2: 0
3: 13
4: 98
1110596881_1110596883 7 Left 1110596881 13:77329150-77329172 CCACCATTCATTAATTTCGCTTC 0: 1
1: 0
2: 1
3: 15
4: 117
Right 1110596883 13:77329180-77329202 ACTGCTGTTCAGTCCCAGACAGG 0: 1
1: 0
2: 0
3: 13
4: 148
1110596881_1110596888 27 Left 1110596881 13:77329150-77329172 CCACCATTCATTAATTTCGCTTC 0: 1
1: 0
2: 1
3: 15
4: 117
Right 1110596888 13:77329200-77329222 AGGCCCCTACGGAGCCTGATGGG 0: 1
1: 0
2: 0
3: 5
4: 54
1110596881_1110596884 16 Left 1110596881 13:77329150-77329172 CCACCATTCATTAATTTCGCTTC 0: 1
1: 0
2: 1
3: 15
4: 117
Right 1110596884 13:77329189-77329211 CAGTCCCAGACAGGCCCCTACGG 0: 1
1: 0
2: 3
3: 14
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110596881 Original CRISPR GAAGCGAAATTAATGAATGG TGG (reversed) Intergenic