ID: 1110596883

View in Genome Browser
Species Human (GRCh38)
Location 13:77329180-77329202
Sequence ACTGCTGTTCAGTCCCAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 148}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110596879_1110596883 18 Left 1110596879 13:77329139-77329161 CCGGGCTCTTCCCACCATTCATT 0: 1
1: 1
2: 2
3: 21
4: 290
Right 1110596883 13:77329180-77329202 ACTGCTGTTCAGTCCCAGACAGG 0: 1
1: 0
2: 0
3: 13
4: 148
1110596881_1110596883 7 Left 1110596881 13:77329150-77329172 CCACCATTCATTAATTTCGCTTC 0: 1
1: 0
2: 1
3: 15
4: 117
Right 1110596883 13:77329180-77329202 ACTGCTGTTCAGTCCCAGACAGG 0: 1
1: 0
2: 0
3: 13
4: 148
1110596878_1110596883 26 Left 1110596878 13:77329131-77329153 CCTGGTCTCCGGGCTCTTCCCAC 0: 1
1: 0
2: 1
3: 42
4: 334
Right 1110596883 13:77329180-77329202 ACTGCTGTTCAGTCCCAGACAGG 0: 1
1: 0
2: 0
3: 13
4: 148
1110596880_1110596883 8 Left 1110596880 13:77329149-77329171 CCCACCATTCATTAATTTCGCTT 0: 1
1: 0
2: 0
3: 9
4: 122
Right 1110596883 13:77329180-77329202 ACTGCTGTTCAGTCCCAGACAGG 0: 1
1: 0
2: 0
3: 13
4: 148
1110596882_1110596883 4 Left 1110596882 13:77329153-77329175 CCATTCATTAATTTCGCTTCAAT 0: 1
1: 0
2: 3
3: 30
4: 244
Right 1110596883 13:77329180-77329202 ACTGCTGTTCAGTCCCAGACAGG 0: 1
1: 0
2: 0
3: 13
4: 148
1110596877_1110596883 27 Left 1110596877 13:77329130-77329152 CCCTGGTCTCCGGGCTCTTCCCA 0: 1
1: 0
2: 1
3: 21
4: 278
Right 1110596883 13:77329180-77329202 ACTGCTGTTCAGTCCCAGACAGG 0: 1
1: 0
2: 0
3: 13
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110596883 Original CRISPR ACTGCTGTTCAGTCCCAGAC AGG Intergenic