ID: 1110596883

View in Genome Browser
Species Human (GRCh38)
Location 13:77329180-77329202
Sequence ACTGCTGTTCAGTCCCAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 148}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110596879_1110596883 18 Left 1110596879 13:77329139-77329161 CCGGGCTCTTCCCACCATTCATT 0: 1
1: 1
2: 2
3: 21
4: 290
Right 1110596883 13:77329180-77329202 ACTGCTGTTCAGTCCCAGACAGG 0: 1
1: 0
2: 0
3: 13
4: 148
1110596882_1110596883 4 Left 1110596882 13:77329153-77329175 CCATTCATTAATTTCGCTTCAAT 0: 1
1: 0
2: 3
3: 30
4: 244
Right 1110596883 13:77329180-77329202 ACTGCTGTTCAGTCCCAGACAGG 0: 1
1: 0
2: 0
3: 13
4: 148
1110596881_1110596883 7 Left 1110596881 13:77329150-77329172 CCACCATTCATTAATTTCGCTTC 0: 1
1: 0
2: 1
3: 15
4: 117
Right 1110596883 13:77329180-77329202 ACTGCTGTTCAGTCCCAGACAGG 0: 1
1: 0
2: 0
3: 13
4: 148
1110596877_1110596883 27 Left 1110596877 13:77329130-77329152 CCCTGGTCTCCGGGCTCTTCCCA 0: 1
1: 0
2: 1
3: 21
4: 278
Right 1110596883 13:77329180-77329202 ACTGCTGTTCAGTCCCAGACAGG 0: 1
1: 0
2: 0
3: 13
4: 148
1110596878_1110596883 26 Left 1110596878 13:77329131-77329153 CCTGGTCTCCGGGCTCTTCCCAC 0: 1
1: 0
2: 1
3: 42
4: 334
Right 1110596883 13:77329180-77329202 ACTGCTGTTCAGTCCCAGACAGG 0: 1
1: 0
2: 0
3: 13
4: 148
1110596880_1110596883 8 Left 1110596880 13:77329149-77329171 CCCACCATTCATTAATTTCGCTT 0: 1
1: 0
2: 0
3: 9
4: 122
Right 1110596883 13:77329180-77329202 ACTGCTGTTCAGTCCCAGACAGG 0: 1
1: 0
2: 0
3: 13
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110596883 Original CRISPR ACTGCTGTTCAGTCCCAGAC AGG Intergenic
901762011 1:11477954-11477976 TCTGCTGTACAGTCCCTGGCTGG - Intergenic
903672530 1:25045190-25045212 ACTGCTTTTCTGTCCCAGAAAGG - Intergenic
904946895 1:34206065-34206087 ACCGCTGCTCAGTCCCAGGGCGG - Intronic
905683781 1:39894092-39894114 ATTGCTTTTCAGTCCCAGATGGG + Intergenic
913220959 1:116660023-116660045 ACTGCTGCTGAGCCCCAGCCTGG - Intronic
920199178 1:204249013-204249035 TCTGCTGTTCAATCCCAGAGAGG - Intronic
920514235 1:206572590-206572612 CCAGCTGTTCAGTCCCAGGTAGG - Intronic
921677433 1:217991656-217991678 ACTGCTAATCTTTCCCAGACTGG - Intergenic
922576616 1:226665164-226665186 GCTGCTGCTCAGCCCCAGGCAGG - Intronic
1067279597 10:44861254-44861276 CCTCCTGTTCATCCCCAGACTGG + Intergenic
1071228534 10:83560006-83560028 ACTTCTGTTCTGTGCCAGAGAGG - Intergenic
1072530727 10:96316291-96316313 TCTGCTTTTCTGTGCCAGACTGG + Intronic
1073429420 10:103476622-103476644 ACTGCTGGGAAGTCCCAGGCTGG + Intronic
1074353708 10:112762809-112762831 ACTGCTGTCCAGGCCCAGCACGG - Intronic
1079392831 11:20037050-20037072 GGTGCTGGTCAGTCCCAAACTGG - Intronic
1080128964 11:28770640-28770662 ACTAGTGTTCAGTTCCAGCCTGG + Intergenic
1084062537 11:66685668-66685690 TCTGCTGTTTAATTCCAGACTGG - Exonic
1084089735 11:66871651-66871673 CCTGCTGTCCAGGCCCAGCCAGG + Intronic
1091459409 12:632573-632595 CAAGCTGCTCAGTCCCAGACAGG - Intronic
1098950523 12:76636346-76636368 CCTGCTGTGCAGTGACAGACAGG + Intergenic
1103508437 12:121456787-121456809 ACTGCTGTTGAGGTCCAGGCAGG - Intronic
1104278071 12:127348460-127348482 ACTGCTTTTCAGTTTCATACTGG + Intergenic
1104555621 12:129797507-129797529 ACAGCTGATCAGACCCAGAGTGG + Intronic
1110596883 13:77329180-77329202 ACTGCTGTTCAGTCCCAGACAGG + Intergenic
1118464001 14:66014388-66014410 ACCGCTGTGGAGTCCCAGACAGG + Intergenic
1118674234 14:68165646-68165668 ACTTCTAGTCAGTCCAAGACTGG + Intronic
1119703368 14:76769744-76769766 AATGCTGTTAAGTCCCAGGAGGG + Intronic
1120024782 14:79570567-79570589 AAGGCTGTTCAGACCCAGTCAGG + Intronic
1122238944 14:100349105-100349127 CCTGCTTTTCACTCTCAGACAGG + Intronic
1127272772 15:57416000-57416022 ACAGCGGTTCAGTCTCAGAGAGG - Intronic
1133225636 16:4339058-4339080 ACTGCCCTTCTGTCCCAGAGGGG + Exonic
1133955008 16:10434977-10434999 ACTGCTGTTCAAGACCAGCCTGG - Intronic
1134084910 16:11349665-11349687 CCTGCTGTTCAACCCCAGGCAGG - Intronic
1138339073 16:56276816-56276838 ACTGAGATTCAGTCCCAAACAGG - Intronic
1139550991 16:67673002-67673024 AGAGCTGGTCAGTCCCACACTGG - Intergenic
1203075568 16_KI270728v1_random:1120477-1120499 GCTCCTGTTCTGTCCCTGACCGG + Intergenic
1143103207 17:4515142-4515164 TCTGCGGTTCTGTCCCAGGCTGG + Intronic
1143976245 17:10832013-10832035 GTTGCTGTATAGTCCCAGACTGG - Intronic
1144653867 17:17023175-17023197 ACTGTTATTCAGTCGCAGACAGG + Intergenic
1144947035 17:18974844-18974866 ACTGGTGTCTAGTCCCAGCCAGG - Intronic
1148043954 17:44730943-44730965 ACTGCTCTTCTGTCCCTGTCAGG + Exonic
1149854815 17:60072605-60072627 TCTGCTGTTCAGTCCTAGGAGGG + Intronic
1150796860 17:68245946-68245968 ACAGCTGTTCAGTCAAAAACAGG + Intergenic
1151199628 17:72458143-72458165 AATGTTGTTAAGTCCCAGAAGGG + Intergenic
1152963560 18:95789-95811 ACCGCTGTGCAGACCCAGGCTGG + Intergenic
1153083421 18:1255361-1255383 AGTACAGTTCAGTCCCTGACGGG + Intergenic
1154010821 18:10572389-10572411 ACTGCTGTGCACCCCCAGACTGG - Intergenic
1157212149 18:45752809-45752831 ACTTCTATGCATTCCCAGACAGG + Intergenic
1158449726 18:57553406-57553428 CCTGCTGCCCAGTCCCAGAGAGG + Intronic
1159301966 18:66584652-66584674 ACTGCTCTTTAGTGACAGACTGG + Intronic
1161254772 19:3301783-3301805 ACTGCTGTGCAGCCTCAGGCAGG - Intergenic
1161667449 19:5585896-5585918 ACGGCAGCTCAGGCCCAGACAGG + Intergenic
1165285604 19:34839166-34839188 GCGGCTGTTTAGACCCAGACCGG + Intergenic
1166076341 19:40415779-40415801 TCTTCTGTCCAGTCCCAGGCTGG + Intergenic
927280480 2:21300809-21300831 CCTTATGTTCAGTCCAAGACTGG - Intergenic
928323242 2:30300550-30300572 TCTGCTGTTCTGTCACAGACAGG - Intronic
928361418 2:30665039-30665061 ACTGCTTCTCAGGCACAGACGGG + Intergenic
933918580 2:87021780-87021802 ACTGCTGGCCAGTCCCAAAATGG - Exonic
934004415 2:87748135-87748157 ACTGCTGGCCAGTCCCAAAATGG + Exonic
935408467 2:102735006-102735028 ACTGCTGTCCTGTCTCAGAAGGG - Intronic
935767373 2:106382154-106382176 ACTGCTGGCCAGTCCCAAAATGG + Intergenic
937302443 2:120851581-120851603 ACTCCAGTTCAGTACCAGCCAGG - Intronic
941819968 2:169834643-169834665 ACTGCTTTTTCGTCCCAGCCAGG + Intronic
941967747 2:171316321-171316343 ACTGCTGCTCATTTCCTGACTGG - Intergenic
943649264 2:190439214-190439236 ACTGTTATTCATTCCCAGAAAGG + Intronic
944494582 2:200293987-200294009 ATTTCTTTTCAGTCTCAGACTGG - Intergenic
947837746 2:233187843-233187865 ACTACTGTTCAGGCCCTGCCTGG - Intronic
948318727 2:237051923-237051945 ACTCCTGTTCCTTCCCAGAGAGG - Intergenic
948795135 2:240398803-240398825 TCTGCTGTGCTGTCCCAGAGGGG - Intergenic
1170094344 20:12629423-12629445 ACTGCTGTGCCAGCCCAGACTGG - Intergenic
1170534959 20:17331600-17331622 TCTGGTGGTCAGTCACAGACTGG - Intronic
1170541102 20:17388879-17388901 ACTGATGTTCAGTCTCAAGCAGG + Intronic
1173383324 20:42565803-42565825 ACAGCTGTGCAGTCCCAGCTGGG + Intronic
1178501474 21:33129123-33129145 ACTGCCCTTCAGTGCCAGCCTGG + Intergenic
1180822484 22:18840229-18840251 ACTGCTGCTGAGCCCCAGCCTGG - Intergenic
1181190482 22:21135797-21135819 ACTGCTGCTGAGCCCCAGCCTGG + Intergenic
1181208722 22:21274724-21274746 ACTGCTGCTGAGCCCCAGCCTGG - Intergenic
1184088135 22:42278122-42278144 ACTGCTGTGCACACCCAGCCTGG + Intronic
1184741709 22:46432300-46432322 ACTGCTGGTGAGTCGCAGCCAGG + Intronic
1203218216 22_KI270731v1_random:20721-20743 ACTGCTGCTGAGCCCCAGCCTGG + Intergenic
1203272623 22_KI270734v1_random:66134-66156 ACTGCTGCTGAGCCCCAGCCTGG - Intergenic
950566829 3:13774370-13774392 ACTGGTGGTCAGCCCCAGCCAGG - Intergenic
951294074 3:20912139-20912161 GCTGGTGTTCAGTTCCAGACTGG + Intergenic
952205756 3:31180721-31180743 ACAGCTGGTCAGGCCCAGAATGG + Intergenic
953760830 3:45685602-45685624 ACTGCCGTCCATGCCCAGACAGG + Exonic
954930794 3:54279615-54279637 ACTGCTCTCCAGTAACAGACAGG - Intronic
956571302 3:70698988-70699010 ACTTCTGTACAGTAACAGACTGG + Intergenic
956850217 3:73221812-73221834 ATTGATATACAGTCCCAGACTGG - Intergenic
968197176 3:196716603-196716625 ACAGCTGTTAAGTTACAGACTGG + Intronic
968868185 4:3227222-3227244 ACTGTACTTCAGCCCCAGACAGG - Intronic
968868195 4:3227256-3227278 ACTGTCCTTCAGCCCCAGACAGG - Intronic
968868204 4:3227290-3227312 ACTGTACTTCAGCCCCAGACAGG - Intronic
968868214 4:3227324-3227346 ACTGTCCTTCAGCCCCAGACAGG - Intronic
968868224 4:3227358-3227380 ACTGTCCTTCAGCCCCAGACAGG - Intronic
968868234 4:3227392-3227414 ACTGTCCTTCAGCCCCAGACAGG - Intronic
968868244 4:3227426-3227448 ACTGTCCTTCAGCCCCAGACAGG - Intronic
968868254 4:3227460-3227482 ACTGTCCTTCAGCCCCAGACAGG - Intronic
968868264 4:3227494-3227516 ACTGTCCTTCAGCCCCAGACAGG - Intronic
968868274 4:3227528-3227550 ACTGTCCTTCAGCCCCAGACAGG - Intronic
968868284 4:3227562-3227584 ACTGTCCTTCAGCCCCAGACAGG - Intronic
968868294 4:3227596-3227618 ACTGTCCTTCAGCCCCAGACAGG - Intronic
968868304 4:3227630-3227652 ACTGTCCTTCAGCCCCAGACAGG - Intronic
968868314 4:3227664-3227686 ACTGTCCTTCAGCCCCAGACAGG - Intronic
968868324 4:3227698-3227720 ACTGTCCTTCAGCCCCAGACAGG - Intronic
968868334 4:3227732-3227754 ACTGTCCTTCAGCCCCAGACAGG - Intronic
968868344 4:3227766-3227788 ACTGTCCTTCAGCCCCAGACAGG - Intronic
968868354 4:3227800-3227822 ACTGTCCTTCAGCCCCAGACAGG - Intronic
970545008 4:17119708-17119730 ATTGCTTTTTAGTCCCAGAAGGG - Intergenic
970566155 4:17334363-17334385 ACTACTGCCCAGTCCCACACTGG + Intergenic
975168223 4:71201995-71202017 ACTGCTGTTGAGTTGGAGACTGG + Intronic
976387926 4:84482037-84482059 ACATCTGTTCAGTCAGAGACTGG - Intergenic
978446076 4:108781293-108781315 ACTCCAGTCCACTCCCAGACAGG + Intergenic
978653912 4:111043528-111043550 AATGGTGTACAGTCCCATACTGG - Intergenic
979866864 4:125766855-125766877 ACTTCTGTTCACTGCCAGCCTGG + Intergenic
980038138 4:127908242-127908264 ACTGCTGTACATTCCTACACTGG - Intergenic
980640188 4:135566878-135566900 CCTGCAGTTCAGTTCCACACTGG - Intergenic
981855943 4:149292823-149292845 ACAGCTGTTCATTCCCAGATTGG + Intergenic
983009328 4:162526486-162526508 ATTGATTTTCAGTCACAGACTGG + Intergenic
985961110 5:3304038-3304060 CTTGCTGTGCAGTCCCAGAGAGG - Intergenic
986394667 5:7316510-7316532 CCTGCTGTGCAGTCCCTGAGAGG - Intergenic
987154760 5:15077969-15077991 ACTGCTGTGCAATGCCAGCCTGG + Intergenic
990181573 5:53166385-53166407 AGTACTGTTCATTCCCAAACAGG + Intergenic
992014627 5:72563396-72563418 CCTGCTGAGCAGTTCCAGACTGG + Intergenic
995762328 5:115576601-115576623 TCTGCTTTTCAGTGCCTGACTGG + Intergenic
997286104 5:132679797-132679819 ACTGCTGTGCAGTCGCACCCAGG - Exonic
998160354 5:139809544-139809566 GCTGCTGTTCAGGCCCTCACTGG - Exonic
998257833 5:140602313-140602335 ACTGCTGTCCAGTCAGAGCCAGG + Intergenic
999283326 5:150379316-150379338 ACAGCAGCTCAGGCCCAGACAGG + Exonic
1003265245 6:4560211-4560233 GCTGCAGTTCCGTCCCAGAAAGG + Intergenic
1006118826 6:31791838-31791860 ACTGCTGCCCAGGCCCAGAGTGG - Intronic
1008018909 6:46553543-46553565 ACTGCTATTAAGTCCCAGTCAGG + Intronic
1008962618 6:57281142-57281164 AATGCTATTCAGTCACAGAAAGG - Intergenic
1013969686 6:116002216-116002238 ACTGGTGTGAAGTCCCAGCCTGG + Intronic
1018108368 6:160511004-160511026 ACTGCTGGCCAGTCCCAAAATGG - Intergenic
1018123965 6:160664211-160664233 ACTGCTGGCCAGTCCCAAAATGG - Exonic
1018128203 6:160702286-160702308 ACTGCTGGCCAGTCCCAAAATGG + Exonic
1018135415 6:160773969-160773991 ACTGCTGGCCAGTCCCAAAATGG + Intergenic
1021556774 7:21927798-21927820 TCAGCTGTTCAGCCCCAGTCAGG + Intronic
1024948809 7:54837354-54837376 ACTACTGTAAAGTCCCACACTGG - Intergenic
1034741001 7:153473199-153473221 GCTGCTCTTCAGACTCAGACTGG + Intergenic
1035283634 7:157792974-157792996 ACTGCTGATTAATCCCAAACTGG - Intronic
1038612847 8:29070686-29070708 GCTGCTGGTCAGGCCCAGCCGGG - Exonic
1039086704 8:33787380-33787402 CCTGCTGTTCTCTCCCAGCCAGG - Intergenic
1039122977 8:34169565-34169587 TTTGCTTTTCAGTCTCAGACAGG - Intergenic
1041204513 8:55484891-55484913 TCTGGCTTTCAGTCCCAGACTGG + Intronic
1047233357 8:123016742-123016764 ACTGCTGTCCCTTCCCAGGCAGG - Intronic
1049217419 8:141414637-141414659 ACTGTTGGGCAGCCCCAGACTGG + Intronic
1050890330 9:10817407-10817429 ACTCCTTTTCAGTGCCATACTGG - Intergenic
1052257181 9:26471531-26471553 ACTGCTTTTCAGCTCCAGAATGG - Intergenic
1054417423 9:64890158-64890180 ACTGCAGCTCAGTCCCATCCAGG - Intergenic
1061595115 9:131623944-131623966 TCTGCTGTTCACTCCCCGAGGGG - Intronic
1061885313 9:133588248-133588270 CCTGCTGCTCTGCCCCAGACAGG - Intergenic
1062734536 9:138127937-138127959 ACCGCTGTGCAGACCCAGGCTGG - Intergenic
1187129591 X:16489529-16489551 ACTTCTGGCCTGTCCCAGACAGG - Intergenic
1189093611 X:38113968-38113990 ACTGTTGTTAAGTCCCATAGGGG - Intronic
1189423924 X:40881503-40881525 ACTGCAGTTCAGTCTCAGAAAGG + Intergenic
1189872419 X:45397903-45397925 ACTGAAGTTCAGTTCCAGAGGGG - Intergenic
1192237136 X:69303152-69303174 ACTGCTGTGCAGATCCAGCCTGG - Intergenic
1201439205 Y:13990194-13990216 TCTGTTGTTCAGGCCCAGGCTGG + Intergenic
1201439447 Y:13992533-13992555 ACTGTTGTTCAGGCCCAGGCTGG + Intergenic
1201445126 Y:14050175-14050197 ACTGTTGTTCAGGCCCAGGCTGG - Intergenic
1201445368 Y:14052514-14052536 TCTGTTGTTCAGGCCCAGGCTGG - Intergenic