ID: 1110596884

View in Genome Browser
Species Human (GRCh38)
Location 13:77329189-77329211
Sequence CAGTCCCAGACAGGCCCCTA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 176}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110596879_1110596884 27 Left 1110596879 13:77329139-77329161 CCGGGCTCTTCCCACCATTCATT 0: 1
1: 1
2: 2
3: 21
4: 290
Right 1110596884 13:77329189-77329211 CAGTCCCAGACAGGCCCCTACGG 0: 1
1: 0
2: 3
3: 14
4: 176
1110596880_1110596884 17 Left 1110596880 13:77329149-77329171 CCCACCATTCATTAATTTCGCTT 0: 1
1: 0
2: 0
3: 9
4: 122
Right 1110596884 13:77329189-77329211 CAGTCCCAGACAGGCCCCTACGG 0: 1
1: 0
2: 3
3: 14
4: 176
1110596882_1110596884 13 Left 1110596882 13:77329153-77329175 CCATTCATTAATTTCGCTTCAAT 0: 1
1: 0
2: 3
3: 30
4: 244
Right 1110596884 13:77329189-77329211 CAGTCCCAGACAGGCCCCTACGG 0: 1
1: 0
2: 3
3: 14
4: 176
1110596881_1110596884 16 Left 1110596881 13:77329150-77329172 CCACCATTCATTAATTTCGCTTC 0: 1
1: 0
2: 1
3: 15
4: 117
Right 1110596884 13:77329189-77329211 CAGTCCCAGACAGGCCCCTACGG 0: 1
1: 0
2: 3
3: 14
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110596884 Original CRISPR CAGTCCCAGACAGGCCCCTA CGG Intergenic