ID: 1110596885

View in Genome Browser
Species Human (GRCh38)
Location 13:77329193-77329215
Sequence GGCTCCGTAGGGGCCTGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 87}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110596885_1110596893 0 Left 1110596885 13:77329193-77329215 CCCAGACAGGCCCCTACGGAGCC 0: 1
1: 0
2: 0
3: 3
4: 87
Right 1110596893 13:77329216-77329238 TGATGGGTACACTCAAAACCCGG 0: 1
1: 0
2: 3
3: 16
4: 123
1110596885_1110596894 7 Left 1110596885 13:77329193-77329215 CCCAGACAGGCCCCTACGGAGCC 0: 1
1: 0
2: 0
3: 3
4: 87
Right 1110596894 13:77329223-77329245 TACACTCAAAACCCGGAAACTGG 0: 1
1: 0
2: 0
3: 9
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110596885 Original CRISPR GGCTCCGTAGGGGCCTGTCT GGG (reversed) Intergenic
900131673 1:1089837-1089859 GGCTGCGGAAGGGACTGTCTGGG - Intronic
900656402 1:3760872-3760894 GCTTCCCTAGGGGCCTGTCGGGG - Intronic
900658780 1:3772747-3772769 GGCTCCGCAGGGGCCGGGCCTGG - Intergenic
901860647 1:12072371-12072393 TACTGCGTAGGGGACTGTCTGGG + Intronic
902545484 1:17186899-17186921 GGCAGGGCAGGGGCCTGTCTGGG + Intergenic
905824823 1:41019807-41019829 GGCTTCCTGGGGGCCTGGCTGGG + Intronic
909292476 1:73901505-73901527 GGATCTGTAGGGGCCTCTGTAGG - Intergenic
918051563 1:180977361-180977383 GGCTCCCCCAGGGCCTGTCTGGG - Intronic
918143627 1:181737812-181737834 GGCTAAGAAGGGGCTTGTCTGGG - Intronic
924608941 1:245558113-245558135 GGCTCAGTAGGGGACTCTGTAGG + Intronic
1082910202 11:58363950-58363972 GGCTGCATAGGGGCCTGTTGTGG + Intergenic
1084735243 11:71101220-71101242 GGGTCCACAGGAGCCTGTCTTGG - Intronic
1085128644 11:74019013-74019035 TGCTACGAAGGGGCCTGACTAGG + Intronic
1093866857 12:24237934-24237956 GGCCCAGCAGGGTCCTGTCTGGG - Intergenic
1096221229 12:49829108-49829130 GGCTCTGCAGGGGCCTGGATGGG - Intergenic
1108529828 13:51318411-51318433 GGCACCTTAGGGGTCTATCTGGG + Intergenic
1110596885 13:77329193-77329215 GGCTCCGTAGGGGCCTGTCTGGG - Intergenic
1114654582 14:24308436-24308458 GGATCATTAGGGTCCTGTCTGGG + Exonic
1120780024 14:88479004-88479026 GGCTCGGTAGCGGCCTGACGTGG + Exonic
1125766204 15:42138199-42138221 GGGTCTGTAGGGGGCTGTCCTGG - Intergenic
1127275248 15:57438103-57438125 GACACCGTAGGAGCCTGCCTTGG - Exonic
1132723826 16:1330281-1330303 GGCTTGGTAGGACCCTGTCTTGG + Intergenic
1132735619 16:1384404-1384426 GGACCCGTGGGGGCCTGGCTGGG - Intronic
1133318031 16:4895899-4895921 GGCTCCTTAGGGGCCTCACTGGG + Intronic
1136044351 16:27603508-27603530 GGCTCCGAGAGGGCCTCTCTGGG - Intronic
1137444741 16:48524790-48524812 CACTCCCTAGGGGCCTGGCTGGG - Intergenic
1142227523 16:88884858-88884880 GGCTGCAGAGGGGCCTGTCCTGG - Intronic
1143016182 17:3892447-3892469 GGCTGCGCAGGGTCCTGCCTTGG - Intronic
1143033689 17:3982405-3982427 GGCTCCGTGTGCGGCTGTCTCGG - Intergenic
1144042242 17:11422356-11422378 GGCTCGGTAGTGGCTTGTCCAGG - Intronic
1144826454 17:18108183-18108205 CCCTCCGGAGGGGCCAGTCTGGG - Intergenic
1145019272 17:19416848-19416870 GCCTCCGCAAGGGCCTCTCTTGG + Exonic
1147580715 17:41625729-41625751 GGGGCCGTCTGGGCCTGTCTGGG - Intergenic
1150291045 17:63982400-63982422 GCCACTGTAGGGGCCTGTCGTGG + Intergenic
1150411062 17:64940930-64940952 AGCTCCGTCGGTGGCTGTCTTGG + Intergenic
1152638459 17:81439726-81439748 GGCCCTGTGGGGGCCTTTCTGGG - Intronic
1152669419 17:81593359-81593381 GGATCCGTACTGGCCTGTGTGGG - Intronic
1152807430 17:82362807-82362829 GGGTCCTCAGGGCCCTGTCTGGG - Exonic
1154323583 18:13374232-13374254 GCCTCCATAGGAGCCTGTGTGGG - Intronic
1161271540 19:3392528-3392550 GGCTCCCTCAGGGGCTGTCTCGG - Intronic
1161505228 19:4640071-4640093 AGCTCATTAGGGGCCAGTCTGGG - Exonic
1162783548 19:13020263-13020285 GGCTCATGAGGGGCGTGTCTGGG + Intronic
1163302841 19:16458468-16458490 GGCTCTGTAGAGGCATGTATGGG - Intronic
1163696935 19:18768808-18768830 GGGTCCCTCGGGGCCTGACTGGG + Intronic
1164830108 19:31313770-31313792 GGCTCCGATGGGGCCTTTCTAGG - Intronic
925905616 2:8538184-8538206 GGCTCAGTGGGAGCCTGGCTGGG - Intergenic
938120650 2:128631030-128631052 CCCTCCGTAGGGGCAGGTCTAGG - Intergenic
939335848 2:140826957-140826979 GGCTCTGTAGGAGACTGGCTGGG - Intronic
946404567 2:219485367-219485389 GGCTCCGCTGGGGCTTCTCTCGG + Exonic
1172181437 20:33006252-33006274 GGCGCAGGAGGGGCCGGTCTTGG + Intergenic
1175465107 20:59185519-59185541 GTCTCAGTGGGGGCCTGCCTGGG - Intergenic
1176083482 20:63285338-63285360 GCCTCCTTCGGGGCCTGACTGGG + Intronic
1176138472 20:63535241-63535263 GGGTCCTCAGGGGCCTGTCCTGG - Intronic
1176966983 21:15222316-15222338 GGATCAGCAGGGGACTGTCTGGG + Intergenic
1179479158 21:41666795-41666817 GGACCCGGAGGGGCCTCTCTGGG + Intergenic
1183204445 22:36409070-36409092 GGGACTGTAGGGGACTGTCTTGG + Intergenic
1184193100 22:42908278-42908300 GGCTCCTTGGGGGCCAGGCTAGG - Intronic
1185230614 22:49678381-49678403 GGAGCCGTAGGGGCCTCTCAGGG + Intergenic
950628340 3:14264943-14264965 GGCTTCCTCAGGGCCTGTCTGGG - Intergenic
954034580 3:47844401-47844423 GGCATGGTAGGGGCCTGTCTGGG + Intronic
954699833 3:52445410-52445432 GGCTGGGTAGGGGCCTAGCTGGG + Intergenic
961324461 3:126102113-126102135 GGCTCCCGGGGGGCCTGGCTTGG + Intergenic
968213959 3:196872124-196872146 GGCTCCTTAAGGGGCTGTTTAGG + Intronic
968575539 4:1364379-1364401 GGCTCCGTGGGGGCTGGGCTTGG + Intronic
969834695 4:9831095-9831117 GGCTTCTTAGGGGTCTGTTTGGG + Intronic
975485955 4:74934075-74934097 GGCTTCGTAGGAGCCACTCTCGG + Intronic
976169306 4:82286346-82286368 GTCTCCTTAGGGGCCAGGCTCGG - Intergenic
985524387 5:394729-394751 GGCTCCGATTGGGCCTGTGTGGG + Intronic
985571415 5:647552-647574 GGCTCCATGGGGGCCTGTGGAGG + Intronic
994509327 5:100684124-100684146 GGCTCAATAGTGGTCTGTCTGGG + Intergenic
1001564322 5:172689803-172689825 GGCAGCGGAGGGGCCTGGCTGGG - Exonic
1003241184 6:4347079-4347101 GGCTCCTGGTGGGCCTGTCTTGG + Intergenic
1003545223 6:7052571-7052593 GGCGCCCTCGCGGCCTGTCTGGG + Intergenic
1006515092 6:34541303-34541325 GGGCCCTCAGGGGCCTGTCTGGG - Intronic
1006656368 6:35596958-35596980 GGGTCCATAGCTGCCTGTCTTGG + Intronic
1010372197 6:75123374-75123396 GGCTCTGTAGGGGCTTCTGTTGG + Exonic
1014218192 6:118773623-118773645 GGAGGTGTAGGGGCCTGTCTGGG - Intergenic
1014218209 6:118773684-118773706 GGAGGTGTAGGGGCCTGTCTGGG - Intergenic
1014218227 6:118773745-118773767 GGAGGTGTAGGGGCCTGTCTGGG - Intergenic
1017254056 6:152313389-152313411 GACTTCGTAGGGGCCTGAATAGG - Intronic
1018959886 6:168440957-168440979 GGCTGCGCAGTGGCCTGTCCGGG - Intergenic
1021613290 7:22478110-22478132 GCCTCAGCAGGGACCTGTCTGGG - Intronic
1026903853 7:74051607-74051629 GTCTCCAGATGGGCCTGTCTGGG - Intronic
1032107144 7:129042043-129042065 GAGTCCTTAGGCGCCTGTCTGGG - Intronic
1034556987 7:151856380-151856402 GCCTCCGCAGGGGCCCGCCTCGG - Intronic
1044786733 8:95801904-95801926 GGCTGCTTAGGAGACTGTCTGGG + Intergenic
1048865630 8:138759454-138759476 GCCTTCCTAAGGGCCTGTCTAGG + Intronic
1053446754 9:38158815-38158837 GGGTCAGTAGGGGGCTGTATGGG + Intergenic
1061396743 9:130347632-130347654 GTCTCCGTGGGGGTCTCTCTAGG - Intronic
1185477529 X:424419-424441 GCGTGCGTAGGGGCCTCTCTGGG + Intergenic
1200235020 X:154463955-154463977 TGCCGCGAAGGGGCCTGTCTGGG + Exonic