ID: 1110596887

View in Genome Browser
Species Human (GRCh38)
Location 13:77329199-77329221
Sequence CAGGCCCCTACGGAGCCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 98}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110596880_1110596887 27 Left 1110596880 13:77329149-77329171 CCCACCATTCATTAATTTCGCTT 0: 1
1: 0
2: 0
3: 9
4: 122
Right 1110596887 13:77329199-77329221 CAGGCCCCTACGGAGCCTGATGG 0: 1
1: 0
2: 0
3: 13
4: 98
1110596882_1110596887 23 Left 1110596882 13:77329153-77329175 CCATTCATTAATTTCGCTTCAAT 0: 1
1: 0
2: 3
3: 30
4: 244
Right 1110596887 13:77329199-77329221 CAGGCCCCTACGGAGCCTGATGG 0: 1
1: 0
2: 0
3: 13
4: 98
1110596881_1110596887 26 Left 1110596881 13:77329150-77329172 CCACCATTCATTAATTTCGCTTC 0: 1
1: 0
2: 1
3: 15
4: 117
Right 1110596887 13:77329199-77329221 CAGGCCCCTACGGAGCCTGATGG 0: 1
1: 0
2: 0
3: 13
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110596887 Original CRISPR CAGGCCCCTACGGAGCCTGA TGG Intergenic