ID: 1110597734

View in Genome Browser
Species Human (GRCh38)
Location 13:77337691-77337713
Sequence TCTGAAGACTCACATAGATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110597731_1110597734 7 Left 1110597731 13:77337661-77337683 CCACAGGACTTTCATTGGCCAGC No data
Right 1110597734 13:77337691-77337713 TCTGAAGACTCACATAGATATGG No data
1110597729_1110597734 17 Left 1110597729 13:77337651-77337673 CCTTCTTTGGCCACAGGACTTTC No data
Right 1110597734 13:77337691-77337713 TCTGAAGACTCACATAGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110597734 Original CRISPR TCTGAAGACTCACATAGATA TGG Intergenic
No off target data available for this crispr