ID: 1110599278

View in Genome Browser
Species Human (GRCh38)
Location 13:77353253-77353275
Sequence CCCAGAAGATAAAGTACAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110599278_1110599280 10 Left 1110599278 13:77353253-77353275 CCTATTGTACTTTATCTTCTGGG No data
Right 1110599280 13:77353286-77353308 TTTGCTTTTCTAACTACCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110599278 Original CRISPR CCCAGAAGATAAAGTACAAT AGG (reversed) Intergenic
No off target data available for this crispr