ID: 1110607212

View in Genome Browser
Species Human (GRCh38)
Location 13:77446859-77446881
Sequence TTCTAGCCTCATCCTAAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110607212_1110607216 15 Left 1110607212 13:77446859-77446881 CCCCTCTTAGGATGAGGCTAGAA No data
Right 1110607216 13:77446897-77446919 AAAAATATTATTTTCAGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110607212 Original CRISPR TTCTAGCCTCATCCTAAGAG GGG (reversed) Intergenic
No off target data available for this crispr