ID: 1110613390

View in Genome Browser
Species Human (GRCh38)
Location 13:77514122-77514144
Sequence GGTGTGATTAGAACAAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110613390_1110613395 12 Left 1110613390 13:77514122-77514144 CCTGCTTTTGTTCTAATCACACC No data
Right 1110613395 13:77514157-77514179 GATGGTGCCCACCCACATTGAGG 0: 72
1: 607
2: 1158
3: 1554
4: 1645
1110613390_1110613397 16 Left 1110613390 13:77514122-77514144 CCTGCTTTTGTTCTAATCACACC No data
Right 1110613397 13:77514161-77514183 GTGCCCACCCACATTGAGGGTGG 0: 73
1: 537
2: 1126
3: 1214
4: 1090
1110613390_1110613396 13 Left 1110613390 13:77514122-77514144 CCTGCTTTTGTTCTAATCACACC No data
Right 1110613396 13:77514158-77514180 ATGGTGCCCACCCACATTGAGGG 0: 79
1: 550
2: 1096
3: 1172
4: 954
1110613390_1110613392 -10 Left 1110613390 13:77514122-77514144 CCTGCTTTTGTTCTAATCACACC No data
Right 1110613392 13:77514135-77514157 TAATCACACCGGCAGCTGATTGG No data
1110613390_1110613393 -6 Left 1110613390 13:77514122-77514144 CCTGCTTTTGTTCTAATCACACC No data
Right 1110613393 13:77514139-77514161 CACACCGGCAGCTGATTGGATGG No data
1110613390_1110613398 17 Left 1110613390 13:77514122-77514144 CCTGCTTTTGTTCTAATCACACC No data
Right 1110613398 13:77514162-77514184 TGCCCACCCACATTGAGGGTGGG 0: 71
1: 535
2: 1112
3: 1055
4: 825

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110613390 Original CRISPR GGTGTGATTAGAACAAAAGC AGG (reversed) Intergenic
No off target data available for this crispr