ID: 1110613818

View in Genome Browser
Species Human (GRCh38)
Location 13:77519504-77519526
Sequence GGCAAGGTGGCACACACCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110613818_1110613826 17 Left 1110613818 13:77519504-77519526 CCATAGGTGTGTGCCACCTTGCC No data
Right 1110613826 13:77519544-77519566 TTTATTTTTCTGTAGATATGGGG No data
1110613818_1110613825 16 Left 1110613818 13:77519504-77519526 CCATAGGTGTGTGCCACCTTGCC No data
Right 1110613825 13:77519543-77519565 ATTTATTTTTCTGTAGATATGGG No data
1110613818_1110613824 15 Left 1110613818 13:77519504-77519526 CCATAGGTGTGTGCCACCTTGCC No data
Right 1110613824 13:77519542-77519564 TATTTATTTTTCTGTAGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110613818 Original CRISPR GGCAAGGTGGCACACACCTA TGG (reversed) Intergenic
No off target data available for this crispr