ID: 1110619555

View in Genome Browser
Species Human (GRCh38)
Location 13:77579731-77579753
Sequence CGTTGTATCTGGAGTAGAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 289}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110619555 Original CRISPR CGTTGTATCTGGAGTAGAGT AGG Intronic
900017764 1:165113-165135 TTTTGTATTTGTAGTAGAGTTGG - Intergenic
900048023 1:523709-523731 TTTTGTATTTGTAGTAGAGTTGG - Intergenic
900070241 1:765569-765591 TTTTGTATTTGTAGTAGAGTTGG - Intergenic
901087584 1:6620845-6620867 TTTTGTATCTTTAGTAGAGTCGG - Intronic
901725801 1:11241147-11241169 CTTTGTATTTTTAGTAGAGTTGG - Intronic
901858000 1:12056641-12056663 CGTTGTAAATGGAGGTGAGTTGG - Intergenic
902017361 1:13319021-13319043 TTTTGTATTTGTAGTAGAGTTGG - Intronic
902363754 1:15957439-15957461 CGGTGTATCTGGAGAGGAGCAGG + Intronic
902416948 1:16245482-16245504 TTTTGTATCTGTAGTAGAGAAGG + Intergenic
902706190 1:18206650-18206672 CAATGTAGCTGGAGCAGAGTGGG + Intronic
903947002 1:26970356-26970378 TTTTGTATTTGTAGTAGAGTAGG + Intergenic
904945814 1:34197922-34197944 GGTTGGAACTGGGGTAGAGTGGG + Intronic
905108637 1:35578526-35578548 CGTTCCCTCTGGAGGAGAGTGGG + Intronic
905383097 1:37578266-37578288 TTTTGTATTTTGAGTAGAGTTGG - Intronic
905388935 1:37623930-37623952 TTTTGTATCTTTAGTAGAGTTGG + Intronic
910695639 1:90012005-90012027 TGTTGTATCTTGAGTAGAGATGG + Intronic
910902522 1:92136819-92136841 AGTGGTATCTGCTGTAGAGTTGG + Intronic
911682779 1:100737132-100737154 AGTTGTAAATGGAGTACAGTAGG - Intronic
912824257 1:112891159-112891181 TGTTGTATCTTTAGTAGAGACGG + Intergenic
915365462 1:155312807-155312829 CTTTGTATTTTGAGTAGAGATGG - Intronic
915843527 1:159238154-159238176 CTTTGTATCTTTAGTAGAGACGG - Intergenic
917284728 1:173411945-173411967 CTTTGTATCTTTAGTAGAGACGG - Intergenic
918995741 1:191757052-191757074 CATTGCATCTGGAGGAGAGGTGG + Intergenic
922105605 1:222510981-222511003 TTTTGTATTTGTAGTAGAGTTGG - Intergenic
922265947 1:223983607-223983629 TTTTGTATTTGTAGTAGAGTTGG - Intergenic
1063262751 10:4408749-4408771 GGTTTTATCTGGAGAAGCGTGGG - Intergenic
1063381416 10:5588528-5588550 GGTTCTATGTGGAGTGGAGTTGG - Intergenic
1063432575 10:6003738-6003760 CTTTGTATTTTTAGTAGAGTCGG + Intergenic
1064399050 10:15005513-15005535 TGTTGTATTTGTAGTAGAGAGGG - Intergenic
1064813909 10:19234697-19234719 CATAGTGTCTGGAGTATAGTAGG - Intronic
1065536310 10:26718211-26718233 CTTTGTATTTTAAGTAGAGTTGG + Intronic
1065612591 10:27487050-27487072 CGTTGTAACTGGGGAAGACTTGG - Intergenic
1066535779 10:36389808-36389830 TGTTGTATTTGTAGTAGAGACGG - Intergenic
1066728572 10:38416339-38416361 TTTTGTATTTGTAGTAGAGTTGG + Intergenic
1067311488 10:45117873-45117895 TTTTGTATTTTGAGTAGAGTCGG - Intergenic
1069638982 10:69943016-69943038 TGTTGTATTTTTAGTAGAGTTGG + Intronic
1071551675 10:86570916-86570938 TTTTGTATTTGGAGTAGAGACGG + Intergenic
1072233637 10:93434258-93434280 TGTTGTATTTGTAGTAGAGACGG - Intronic
1072596822 10:96880566-96880588 TGTTGTATTTGTAGTAGAGATGG + Intronic
1072783173 10:98263901-98263923 TTTTGTATCTGTAGTAGAGACGG + Intronic
1074549340 10:114428161-114428183 TTTTGTATTTTGAGTAGAGTCGG + Intergenic
1075175743 10:120159181-120159203 GGGTCTATCTGGAGTTGAGTGGG - Intergenic
1075206646 10:120454957-120454979 TTTTGTATCTTGAGTAGAGATGG + Intergenic
1075787290 10:125058619-125058641 CTTTGTATTTTTAGTAGAGTTGG - Intronic
1076974361 11:160302-160324 TTTTGTATTTGTAGTAGAGTTGG - Intergenic
1077189816 11:1251219-1251241 GGTGGTCTCTGGAGTAGAGGAGG - Exonic
1077953490 11:6988334-6988356 ATTTGTGTCTGGATTAGAGTAGG + Intergenic
1078297732 11:10091067-10091089 CATAGTATCTTGAGTATAGTAGG - Intronic
1078517055 11:12031799-12031821 CCTTGTCTCTGGAGGAGAGCAGG + Intergenic
1080007455 11:27424916-27424938 CTTTGTATTTGTAGTAGAGACGG + Intronic
1080011801 11:27467393-27467415 TTTTGTATCTTTAGTAGAGTCGG - Intronic
1080463632 11:32477044-32477066 CCTTGTTTTAGGAGTAGAGTGGG + Intergenic
1081155701 11:39687087-39687109 TGTTGTATTTTTAGTAGAGTCGG - Intergenic
1083034888 11:59627983-59628005 CACTGTATCTGGAGTAATGTGGG + Intergenic
1085545519 11:77314190-77314212 TTTTGTATCTGTAGTAGAGACGG - Intergenic
1085594990 11:77801256-77801278 TTTTGTATCTTTAGTAGAGTTGG - Intronic
1087658317 11:100954287-100954309 CGCAGTACCTGGAGTAGAGTAGG - Intronic
1087660851 11:100986394-100986416 CATTGTGACTGGAGTAGAGTAGG + Intronic
1088677055 11:112204833-112204855 CGTTGTATTTTTAGTAGAGATGG + Intronic
1088719207 11:112576971-112576993 AGTTGTATCTGGAGTAGAGGAGG + Intergenic
1089909390 11:122080854-122080876 TTTTGTATCTTTAGTAGAGTTGG - Intergenic
1090765273 11:129870923-129870945 AGTTGAATGTGGAGTGGAGTAGG - Intronic
1090785052 11:130041250-130041272 TGTTGTATTTGTAGTAGAGACGG - Intergenic
1092260289 12:6949950-6949972 CTTTGTATTTTTAGTAGAGTTGG + Intronic
1092369870 12:7907970-7907992 TGTTGTATCTTTAGTAGAGACGG + Intergenic
1094554288 12:31482996-31483018 CATTGTTGCTGGAGCAGAGTGGG - Intronic
1095144662 12:38711637-38711659 TGTTGTATTTGTAGTAGAGACGG + Intronic
1095948031 12:47764904-47764926 TTTTGTATCTGTAGTAGAGATGG - Intronic
1097112668 12:56673459-56673481 ATTTGTATTTGTAGTAGAGTCGG - Intronic
1098079697 12:66770921-66770943 TGTTGTATCTTTAGTAGAGATGG - Intronic
1098562299 12:71888311-71888333 TCTTGTATCTGTAGTAGAGACGG - Intronic
1099052483 12:77797668-77797690 TGTTGTATTTGTAGTAGAGACGG - Intergenic
1101614614 12:106324367-106324389 CATTGTGACGGGAGTAGAGTTGG + Intronic
1103051908 12:117787460-117787482 TTTTGTATCTGTAGTAGAGGCGG - Intronic
1109839691 13:67905530-67905552 TGTTGTATTTGTAGTAGAGATGG + Intergenic
1110619555 13:77579731-77579753 CGTTGTATCTGGAGTAGAGTAGG + Intronic
1111246266 13:85545976-85545998 CGTGGTCTCTGAGGTAGAGTTGG - Intergenic
1115120978 14:29937495-29937517 CATTATATCTGGCATAGAGTAGG + Intronic
1115542404 14:34433789-34433811 TTTTGTATCTGTAGTAGAGACGG - Exonic
1117266167 14:54089284-54089306 CTTTGTAGCTGGAGAAGATTGGG + Intergenic
1117488457 14:56222876-56222898 TGTTGTAGGTGGGGTAGAGTGGG + Intronic
1117531576 14:56665191-56665213 GGTTTTATCTGGAGGACAGTGGG + Intronic
1118340086 14:64888186-64888208 TGTTGTATTTTTAGTAGAGTCGG + Intergenic
1119600802 14:75975195-75975217 TTTTGTATTTGGAGTAGAGATGG - Intronic
1119683408 14:76610393-76610415 CTTTGTATTTGTAGTAGAGATGG + Intergenic
1121004324 14:90478879-90478901 CTTTGTATTTTGAGTAGAGATGG + Intergenic
1121105346 14:91275675-91275697 CATTGTATCTTTAGTAGAGATGG + Intronic
1122263998 14:100538334-100538356 CCTTGTAGCTGGCGTAGAGCGGG + Exonic
1122709475 14:103645141-103645163 TTTTGTATTTGTAGTAGAGTCGG + Intronic
1124056372 15:26244116-26244138 TGTTGTATTTGTAGTAGAGACGG + Intergenic
1125257093 15:37777634-37777656 TTTTGTATTTGTAGTAGAGTTGG - Intergenic
1126153972 15:45548033-45548055 TGTTGTATTTTTAGTAGAGTCGG + Intergenic
1126360285 15:47838466-47838488 CGTTTTGCCTGAAGTAGAGTTGG + Intergenic
1126872363 15:53003188-53003210 CTTGCTATCTGGAATAGAGTAGG + Intergenic
1128064581 15:64756343-64756365 CTTTGTATCTTTAGTAGAGACGG - Intronic
1128116647 15:65111653-65111675 TTTTGTATCTGTAGTAGAGGTGG + Intronic
1130009107 15:80134158-80134180 CTTTGTATCTTTAGTAGAGACGG + Intronic
1130225500 15:82055095-82055117 TTTTGTATCTGTAGTAGAGATGG - Intergenic
1131105031 15:89727908-89727930 TGTTGTATTTTTAGTAGAGTCGG - Intronic
1131755248 15:95553076-95553098 CGCTGTGTCTGGAGTATAGTGGG - Intergenic
1131800955 15:96069180-96069202 CATTTTATCTGGACTTGAGTAGG - Intergenic
1131972360 15:97905091-97905113 TTTTGTATCTTTAGTAGAGTCGG - Intergenic
1132610741 16:814842-814864 TTTTGTATCTGTAGTAGAGATGG + Intergenic
1132867149 16:2099000-2099022 TTTTGTATTTGTAGTAGAGTCGG + Intronic
1133561381 16:6953555-6953577 TGTTGTATCTTTAGTAGAGATGG + Intronic
1135789123 16:25377289-25377311 TTTTGTATTTTGAGTAGAGTTGG + Intergenic
1135803873 16:25524442-25524464 CTTTGTATTTTTAGTAGAGTAGG + Intergenic
1139768810 16:69255708-69255730 TTTTGTATCTTTAGTAGAGTGGG - Intronic
1141472694 16:84250333-84250355 TGTTGTATCTTTAGTAGAGATGG + Intergenic
1141525554 16:84608932-84608954 CATTGTTTCTGGAGCAAAGTAGG + Intronic
1141577990 16:84977103-84977125 CGTTGCATATGGAGTGGATTTGG + Exonic
1142445899 16:90137342-90137364 TTTTGTATTTGTAGTAGAGTTGG + Intergenic
1142461610 17:98119-98141 TTTTGTATTTGTAGTAGAGTTGG - Intergenic
1142995642 17:3758620-3758642 CTTTGTATTTTGAGTAGAGACGG + Intronic
1143084821 17:4407745-4407767 CTTTGTATTTTTAGTAGAGTCGG - Intergenic
1144064825 17:11615412-11615434 TTTTGTATTTTGAGTAGAGTTGG - Intronic
1147755741 17:42766448-42766470 TGTTATATTTGGAGTAGAGACGG + Intergenic
1148018248 17:44537586-44537608 CTTTGTATTTTTAGTAGAGTCGG + Intergenic
1150270571 17:63861876-63861898 TTTTGTATCTGTAGTAGAGATGG - Intergenic
1150632913 17:66892667-66892689 TGTTGTATCTGAAATAGGGTGGG - Intergenic
1153190230 18:2529880-2529902 TTTTGTATCTTTAGTAGAGTTGG - Intergenic
1153543429 18:6181498-6181520 CTTTGTATTTTTAGTAGAGTGGG + Intronic
1155503150 18:26506677-26506699 CCTTGTGTCTGGAGAAGAGGAGG + Intronic
1158700472 18:59741303-59741325 CGTTGTATTTTTAGTAGAGAGGG + Intergenic
1159652844 18:70998124-70998146 CATTGTATTTGAATTAGAGTGGG - Intergenic
1160296860 18:77646521-77646543 TGTTGTGGCTGGAGTCGAGTGGG + Intergenic
1160651310 19:230486-230508 TTTTGTATTTGTAGTAGAGTTGG - Intergenic
1161637939 19:5400993-5401015 AGATGTAACTGGAGTAGGGTGGG + Intergenic
1161858771 19:6782157-6782179 TATTGTATTTGTAGTAGAGTTGG - Intronic
1164940042 19:32245068-32245090 TTTTGTATTTGTAGTAGAGTTGG + Intergenic
1165005241 19:32799904-32799926 TGTTGTATCTTTAGTAGAGATGG + Intronic
1165614553 19:37188314-37188336 CATTGTATTTTTAGTAGAGTTGG - Intronic
1165984467 19:39755925-39755947 CACTGTGTCTGGAGTAGAGGGGG - Intergenic
1167626997 19:50597376-50597398 TGTTGTATCTTTAGTAGAGATGG - Intergenic
1167656507 19:50767819-50767841 CTTTGTATCTTTAGTAGAGACGG + Intergenic
1168091738 19:54090079-54090101 CTTTGTATTTTTAGTAGAGTCGG + Intergenic
1168328119 19:55548753-55548775 TTTTGTATCTGTAGTAGAGATGG - Intergenic
924984735 2:260373-260395 CATAGTATCTGGAGTGGATTGGG + Intronic
926862942 2:17327931-17327953 TTTTGTATCTGTAGTAGAGATGG - Intergenic
927543393 2:23931838-23931860 TTTTGTATCTGTAGTAGAGACGG - Intronic
927763652 2:25783881-25783903 TTTTGTATTTGTAGTAGAGTCGG - Intronic
927815291 2:26210514-26210536 TTTTGTATCTGTAGTAGAGATGG + Intronic
929000190 2:37340557-37340579 CGTTGTTTCAGAAGTATAGTGGG - Intergenic
929870739 2:45757078-45757100 TTTTGTATTTGGAGTAGAGATGG - Intronic
931613600 2:64131542-64131564 CTTTGTTTCTCGAGTACAGTTGG - Intronic
932045023 2:68339652-68339674 CTATCTACCTGGAGTAGAGTCGG - Intergenic
933645650 2:84810724-84810746 GGTTCTGTCTGGAGGAGAGTGGG - Intronic
935195104 2:100809071-100809093 CTTTGTATTTTGAGTAGAGATGG - Intergenic
936467800 2:112768950-112768972 CTTTGTATTTTGAGTAGAGACGG + Intergenic
937408540 2:121652337-121652359 CGTTGTATTTTTAGTAGAGGCGG + Intergenic
939024416 2:136995103-136995125 GCTGGCATCTGGAGTAGAGTAGG + Intronic
940674651 2:156713903-156713925 TTTTGTATTTGTAGTAGAGTCGG + Intergenic
940870586 2:158856893-158856915 TGTTGTATTTGTAGTAGAGATGG + Intronic
941284226 2:163589038-163589060 TTTTGTATTTGTAGTAGAGTTGG - Intergenic
941470026 2:165873012-165873034 TTTTGTATCTGCAGTAGAGATGG - Intronic
943281933 2:185945930-185945952 TGTTGTATCTTTAGTAGAGACGG - Intergenic
943691896 2:190877996-190878018 CGTTGTATTTTTAGTAGAGATGG + Intergenic
944272558 2:197799991-197800013 CGTTGTACCTGGAAAAGATTCGG + Intergenic
947859076 2:233345980-233346002 TTTTGTATCTGTAGTAGAGAAGG - Intronic
949037870 2:241826466-241826488 CTTTGTATTTTTAGTAGAGTCGG - Intergenic
1169170493 20:3460850-3460872 TTTTGTATCTTCAGTAGAGTTGG + Intergenic
1169889742 20:10439378-10439400 TTTTGTATCTTTAGTAGAGTTGG + Intronic
1170232582 20:14066981-14067003 TGTTGTATTTGTAGTAGAGATGG + Intronic
1172488322 20:35313788-35313810 TTTTGTATCTGTAGTAGAGACGG + Intronic
1173302440 20:41816196-41816218 CTTTGTATCTGCATTGGAGTGGG + Intergenic
1173919063 20:46730433-46730455 GGTTGTGGCTGAAGTAGAGTGGG + Intronic
1174201995 20:48813075-48813097 CGTTGGGGGTGGAGTAGAGTAGG - Intronic
1174793288 20:53499575-53499597 CTTTGTATTTTTAGTAGAGTTGG - Intergenic
1178479900 21:32970922-32970944 TTTTGTATTTGGAGTAGAGACGG - Intergenic
1178595141 21:33946758-33946780 TTTTGTATCTGTAGTAGAGACGG + Intergenic
1178638242 21:34323922-34323944 CCTTGAATCTGGACTAGAATTGG + Intergenic
1178862870 21:36303994-36304016 CTTTGTATCTTTAGTAGAGGCGG + Intergenic
1181891262 22:26065523-26065545 TTTTGTATTTGTAGTAGAGTTGG - Intergenic
1181956864 22:26593694-26593716 TTTTGTATTTGGAGTAGAGATGG + Intronic
1182736909 22:32537327-32537349 TTTTGTATCTGTAGTAGAGATGG + Intronic
1184127172 22:42495820-42495842 CAATGTATCTGTAGAAGAGTAGG + Intergenic
1184532659 22:45066293-45066315 CTTTGTATTTGTAGTAGAGGCGG + Intergenic
1184706908 22:46220770-46220792 TTTTGTATCTTTAGTAGAGTTGG - Intronic
949581478 3:5392749-5392771 GGTTGTTTCTGGAGTGCAGTGGG + Intergenic
950224630 3:11223652-11223674 TGCTGTAGCTGGAGTGGAGTGGG - Intronic
950237448 3:11335867-11335889 TTTTGTATCTTTAGTAGAGTCGG + Intronic
951083090 3:18475771-18475793 TTTTGTATTTGGAGTAGAGACGG - Intergenic
952793525 3:37218718-37218740 TTTTGTATCTGCAGTAGAGATGG - Intergenic
953935697 3:47040147-47040169 TTTTGTATCTGGAGTAGAGACGG + Intronic
954472749 3:50712506-50712528 TTTTGTATCTTTAGTAGAGTCGG + Intronic
955167673 3:56530243-56530265 TTTTGTTTCTGAAGTAGAGTCGG + Intergenic
955673404 3:61425710-61425732 CTTGGTATCTGGAGTGGACTGGG + Intergenic
956141672 3:66152676-66152698 GGTTATATCTGGGGTAGGGTGGG + Intronic
956871510 3:73422604-73422626 GGTTGGATATGGAGTAGAGTTGG + Intronic
958842025 3:99217684-99217706 CCTTGTAGCTGGAGCATAGTAGG - Intergenic
960132168 3:114068876-114068898 TTTTGTATCTGTAGTAGAGATGG - Intronic
962731662 3:138289326-138289348 CCTTGAATCTGGTATAGAGTTGG - Intronic
964404620 3:156336187-156336209 TGTTGTATTTTTAGTAGAGTCGG - Intronic
965232878 3:166075962-166075984 TGTTGTATCTTGAGTTCAGTAGG - Intergenic
966245856 3:177807620-177807642 CGTTGACTCTTAAGTAGAGTAGG - Intergenic
966618095 3:181933845-181933867 TTTTGTATTTTGAGTAGAGTCGG - Intergenic
966734253 3:183176446-183176468 GTTTGTTTCTGGAATAGAGTGGG - Intergenic
967218381 3:187228939-187228961 GGTTGGATCTGGAGGAGGGTGGG + Intronic
967608004 3:191471074-191471096 TTTTGTATCTGGATTAGAGGAGG - Intergenic
968173602 3:196529542-196529564 TGTTGTATCTTTAGTAGAGATGG - Intergenic
968366521 3:198189493-198189515 TTTTGTATTTGTAGTAGAGTTGG + Intergenic
969018722 4:4123975-4123997 TGTTGTATTTGTAGTAGAGATGG - Intergenic
969735269 4:8984729-8984751 TGTTGTATTTGTAGTAGAGAAGG + Intergenic
969786570 4:9462561-9462583 TGTTGTATTTGTAGTAGAGACGG + Intergenic
969794483 4:9516203-9516225 TGTTGTATTTGTAGTAGAGACGG + Intergenic
970071880 4:12168985-12169007 ACTTATATCTGGAGTGGAGTAGG + Intergenic
970182094 4:13409450-13409472 CTTGGTATCAGGATTAGAGTTGG - Intronic
970184778 4:13439515-13439537 TGTTGTATCTTTAGTAGAGATGG + Intronic
970437955 4:16053922-16053944 CTTTGTATTTTTAGTAGAGTAGG - Intronic
971282633 4:25253940-25253962 TGTTGTATTTTGAGTAGAGACGG + Intronic
971999310 4:34009518-34009540 CTTTGTATTTTTAGTAGAGTCGG + Intergenic
972980861 4:44699352-44699374 TTTTGTATCTTTAGTAGAGTCGG + Exonic
973319744 4:48797913-48797935 TGTTGAATCTGGACAAGAGTAGG + Intergenic
978092378 4:104733500-104733522 TGTAGTATAGGGAGTAGAGTAGG - Intergenic
978536810 4:109771217-109771239 TTTTGTATTTTGAGTAGAGTTGG - Intronic
979333405 4:119441377-119441399 TTTTGTATTTGTAGTAGAGTTGG - Intergenic
980048322 4:128013526-128013548 TGTTGTATCTTTAGTAGAGATGG - Intronic
981624638 4:146741801-146741823 AGTTGTGACGGGAGTAGAGTAGG - Intronic
982471528 4:155796977-155796999 CAGTGTATTTGGATTAGAGTAGG - Intronic
983201079 4:164861138-164861160 CTTTGTATCTTTAGTAGAGACGG + Intergenic
983214665 4:164991966-164991988 TTTTGTATTTGTAGTAGAGTCGG - Intergenic
983451211 4:167913632-167913654 CTTTGTATTTTTAGTAGAGTCGG - Intergenic
985235309 4:187866648-187866670 CGTTGTATTTTTAGTAGAGACGG + Intergenic
985372751 4:189303400-189303422 TGTTGTATCTTTAGTAGAGGCGG + Intergenic
985677725 5:1240876-1240898 CGGTCTCTCTGGAGTAGGGTAGG + Intronic
985930921 5:3057251-3057273 GGTTGTATCTGGAGAAGATTTGG + Intergenic
988510288 5:31858887-31858909 TTTTGTATCTTTAGTAGAGTCGG + Intronic
988698143 5:33644900-33644922 TTTTGTATCTGTAGTAGAGACGG + Intronic
990396407 5:55384752-55384774 GTTTGTTTCTGGGGTAGAGTTGG + Intronic
990574841 5:57114370-57114392 TGTTGTATCTTTAGTAGAGATGG - Intergenic
990578840 5:57149560-57149582 TGTTGTATCTTTAGTAGAGACGG - Intergenic
991388525 5:66116860-66116882 GGTTGTGTCTGGAGTCGAGGTGG + Intergenic
991442298 5:66663661-66663683 CACTGTAGCTGGAATAGAGTGGG + Intronic
995932747 5:117469155-117469177 TGTTGTATCAGGAATAGAGAAGG - Intergenic
996247256 5:121280208-121280230 CTTTGTATCTTTAGTAGAGACGG - Intergenic
996962839 5:129271761-129271783 TGTTGTTTTTGGAGTTGAGTAGG - Intergenic
997175230 5:131768637-131768659 TTTTGTATCTGTAGTAGAGATGG - Intronic
997886283 5:137633106-137633128 TTTTGTATTTGTAGTAGAGTTGG - Intronic
997904988 5:137807547-137807569 TTTTGTATCTGTAGTAGAGACGG - Intergenic
999475729 5:151897112-151897134 CTTTGTATTTGGAAAAGAGTTGG - Intronic
1002084775 5:176767194-176767216 TGTTGTATGTTTAGTAGAGTCGG + Intergenic
1002139044 5:177127488-177127510 CTTTGTATCTTTAGTAGAGACGG + Intergenic
1002725744 5:181294703-181294725 TTTTGTATTTGTAGTAGAGTTGG + Intergenic
1003894208 6:10591463-10591485 CATTTTATCTGGAATAAAGTGGG - Intronic
1004666741 6:17755142-17755164 TGTTGTATCTTTAGTAGAGATGG + Intergenic
1006184288 6:32171535-32171557 CCTGGTTTCTGGAGGAGAGTGGG + Exonic
1007578258 6:42939679-42939701 TGTTGTACCTGGAGTGCAGTTGG + Intergenic
1009798079 6:68497559-68497581 TGTTGTATTTTTAGTAGAGTCGG - Intergenic
1010222927 6:73463201-73463223 CTTTGTATTTTTAGTAGAGTCGG + Intronic
1013125746 6:107182493-107182515 TTTTGTATCTGTAGTAGAGACGG + Intronic
1015951979 6:138562474-138562496 TGTTGTATTTGTAGTAGAGATGG - Intronic
1020043085 7:5018836-5018858 CGTTGTATATTTAGTAGAGATGG - Intronic
1021568257 7:22036367-22036389 TTTTGTATTTGTAGTAGAGTTGG + Intergenic
1021887776 7:25156857-25156879 TTTTGTATCTGTAGTAGAGATGG + Intronic
1022057220 7:26750479-26750501 TTTTGTATCTGTAGTAGAGATGG + Intronic
1024763051 7:52623673-52623695 TTTTGTATCTGTAGTAGAGGCGG - Intergenic
1025835649 7:65091192-65091214 TTTTGGCTCTGGAGTAGAGTGGG + Intergenic
1025905427 7:65780668-65780690 TTTTGGCTCTGGAGTAGAGTGGG + Intergenic
1026705710 7:72690921-72690943 TTTTGTATCTGTAGTAGAGACGG + Intronic
1027158618 7:75786160-75786182 TGTTGTATCTGGAATAATGTGGG - Intronic
1027180088 7:75932845-75932867 CTTTGTATTTGTAGTAGAGATGG - Intronic
1028180177 7:87711154-87711176 TGTTGTATTTTGAGTAGAGACGG - Intronic
1028433879 7:90779079-90779101 TTTTGTATCTGTAGTAGAGACGG - Intronic
1030051009 7:105537657-105537679 TGTTGTATTTTTAGTAGAGTCGG - Intronic
1031350798 7:120728459-120728481 CATTGTATCTGTAGTAGAGATGG + Intronic
1034709744 7:153180749-153180771 TTTTGTATCTTTAGTAGAGTTGG + Intergenic
1036819211 8:11926206-11926228 TGTTGTATTTGTAGTAGAGACGG - Intergenic
1037487586 8:19363245-19363267 TTTTGTATTTGTAGTAGAGTTGG + Intronic
1040595666 8:48835238-48835260 CTTTGTCTCTGGAGCAAAGTGGG + Intergenic
1042339202 8:67661311-67661333 CATTGTGGCTGGAGTAGAGTAGG + Intronic
1042503095 8:69530932-69530954 CATTCTGTCTGGAGTACAGTAGG - Intronic
1042565449 8:70105643-70105665 TTTTGTATCTGTAGTAGAGATGG - Intergenic
1045127579 8:99109551-99109573 TGTTGTATTTGTAGTAGAGATGG + Intronic
1045617619 8:103936921-103936943 TTTTGTATCTGTAGTAGAGACGG - Intronic
1047723084 8:127660396-127660418 CTTTGTATCTTTAGTAGAGACGG + Intergenic
1050154296 9:2649560-2649582 CTTTGTATCTTTAGTAGAGATGG + Intronic
1050185397 9:2967682-2967704 CATTGTATTTAGAGTAGGGTAGG + Intergenic
1050954032 9:11632137-11632159 TTTTGTATCTTTAGTAGAGTTGG - Intergenic
1052786774 9:32835702-32835724 CTTTGTATTTGTAGTAGAGATGG - Intergenic
1052895854 9:33747881-33747903 CTTTGTATTTTTAGTAGAGTTGG - Intergenic
1056863661 9:90210561-90210583 TGTTGTATTTGTAGTAGAGATGG + Intergenic
1058041296 9:100304686-100304708 TTTTGTATCTGTAGTAGAGACGG - Intronic
1058956728 9:109955762-109955784 TGTTGTATTTTTAGTAGAGTTGG - Intronic
1059213122 9:112533401-112533423 CTTTGTATTTTTAGTAGAGTGGG - Intronic
1060865023 9:126988791-126988813 AGTTGTGTCTGGAGAAAAGTGGG + Intronic
1061010444 9:127951301-127951323 TGTTGTATCTGGAGCAGAGCTGG - Intronic
1061010704 9:127952885-127952907 TTTTGTATCTGTAGTAGAGACGG + Intronic
1061184455 9:129044162-129044184 TTTTGTATTTTGAGTAGAGTTGG + Intronic
1061986994 9:134135723-134135745 CGTTGTCTCCGGAGTCGATTCGG - Intronic
1062750880 9:138252345-138252367 TTTTGTATTTGTAGTAGAGTTGG + Intergenic
1185874124 X:3688273-3688295 CGTTGTATTTTTAGTAGAGATGG - Intronic
1188692742 X:33150462-33150484 CTTTGTATGTTTAGTAGAGTTGG + Intronic
1194216087 X:91132051-91132073 AATTGTATGTGGAGTAGATTGGG - Intergenic
1195302869 X:103549139-103549161 TGTTGTATTTTTAGTAGAGTTGG + Intergenic
1197787455 X:130213179-130213201 TTTTGTATCTGTAGTAGAGACGG - Intronic
1197795012 X:130289350-130289372 TTTTGTATTTGTAGTAGAGTTGG + Intergenic
1197811358 X:130446617-130446639 TTTTGTATCTGTAGTAGAGATGG + Intergenic
1198079296 X:133223864-133223886 TTTTGTATCTGTAGTAGAGATGG - Intergenic
1198456126 X:136819722-136819744 TTTTGTATCTGTAGTAGAGATGG + Intergenic
1200818461 Y:7557418-7557440 CATCGGATCTGGAGTGGAGTTGG + Intergenic
1201406174 Y:13652494-13652516 CTTTGTATTTTAAGTAGAGTTGG + Intergenic