ID: 1110620172

View in Genome Browser
Species Human (GRCh38)
Location 13:77586010-77586032
Sequence ATGGAGAGTTTCAGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 616
Summary {0: 1, 1: 0, 2: 11, 3: 68, 4: 536}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110620172_1110620182 20 Left 1110620172 13:77586010-77586032 CCCTCCTCCCTGAAACTCTCCAT 0: 1
1: 0
2: 11
3: 68
4: 536
Right 1110620182 13:77586053-77586075 TGTGAGCTTCTCATCTTTGTTGG 0: 1
1: 1
2: 1
3: 11
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110620172 Original CRISPR ATGGAGAGTTTCAGGGAGGA GGG (reversed) Intronic
900206485 1:1433949-1433971 ATGGCGAGCTGAAGGGAGGAGGG + Intergenic
900310831 1:2032472-2032494 AAGGTGAGCTCCAGGGAGGAGGG - Intergenic
900993209 1:6107260-6107282 ATGGAGAGATGGAGGGATGATGG + Intronic
900993232 1:6107366-6107388 ATGGAGAGATGGAGGGATGATGG + Intronic
900993311 1:6107702-6107724 ATGGAGAGATGGAGGGATGATGG + Intronic
900993321 1:6107746-6107768 ATGGAGAGATGGAGGGATGATGG + Intronic
900993413 1:6108074-6108096 ATGGAGAGATGGAGGGATGATGG + Intronic
901143094 1:7048110-7048132 ATGGAGGATTTCAGCGGGGAGGG + Intronic
901217228 1:7561562-7561584 ATGGGCTGGTTCAGGGAGGAGGG + Intronic
901813122 1:11778939-11778961 CTGGAGAGTGTCCGGGAGGGTGG - Exonic
902259850 1:15216501-15216523 TTGGAGAGTTGTAGGGAAGATGG + Intronic
902553846 1:17235240-17235262 AGGGAGAGTGGGAGGGAGGAAGG + Intronic
902595839 1:17508933-17508955 ATGGAGAGGTAGGGGGAGGAAGG - Intergenic
902696366 1:18143426-18143448 ATGGAGAGTTCTAAGCAGGAGGG - Intronic
904451711 1:30617130-30617152 ATGGAGAGTGTGAGCAAGGAAGG + Intergenic
904620737 1:31773559-31773581 ACTGAGAGCTTCAGGGAGGTAGG - Intergenic
905448175 1:38040951-38040973 AGGGAAAGTTCCAGGGAGGGAGG + Intergenic
906251061 1:44311454-44311476 ATAGAGAGTTTCTGGCAGGTAGG - Intronic
906276411 1:44519691-44519713 ATGGAGAGATGGAGGGAGGGGGG - Intronic
906577110 1:46901054-46901076 ATGGCGATTTTCAGGGAACAAGG + Intergenic
906577888 1:46907367-46907389 ATGGTGATTTTCAGGGAACAAGG + Intergenic
907688184 1:56634847-56634869 ATGGAGAATATCAAGGATGAAGG + Intronic
907798473 1:57740924-57740946 AAGGAGGGCTTCATGGAGGAGGG + Intronic
907811663 1:57876950-57876972 ATGAAAAGTTGCAGTGAGGAAGG + Intronic
907874752 1:58474658-58474680 ATGGAAAGTTTCAGGGACTATGG + Intronic
908941901 1:69445343-69445365 ATCGAGAGTAGCAGTGAGGAAGG - Intergenic
909463721 1:75948687-75948709 ATGGCCTGTTTCAGGGAGAAGGG + Intergenic
909765651 1:79352986-79353008 AGGGAGAGTTGCCGGGAGGGAGG - Intergenic
909949924 1:81706744-81706766 GTGGAGAGTTTCTGGAAGCAAGG + Intronic
910500051 1:87880151-87880173 AGGGAGAGAACCAGGGAGGAAGG - Intergenic
910542033 1:88370593-88370615 ATGGAGAATATCAGGGATGTTGG - Intergenic
910738487 1:90489193-90489215 TTGGAGACTTGGAGGGAGGAGGG - Intergenic
912320707 1:108710133-108710155 ATGGAGAATGGCAGGAAGGAGGG - Intergenic
912451383 1:109769765-109769787 AGAGAGTGTTTCAGGAAGGAGGG + Intronic
912462434 1:109844897-109844919 ATGGTGAGTTTCAGTAAGGTAGG + Intergenic
915713992 1:157926734-157926756 ATGCAGAGCTCCAGGGAGGGAGG + Intergenic
916562565 1:165945915-165945937 ATTGACAGTCTCAGGGGGGAGGG - Intergenic
917438501 1:175045148-175045170 ATGGAGAGTCTCTGGGAGACAGG - Intergenic
917618834 1:176774058-176774080 AAGAAGAGTTTCAAGAAGGAAGG - Intronic
917804811 1:178604121-178604143 AGAGAGAGTCCCAGGGAGGAGGG - Intergenic
917897256 1:179503844-179503866 ATGCAGACTTTCAAGGAGTAGGG + Intronic
918183348 1:182105573-182105595 TTGAAGAGTTACAGGGAGGGAGG - Intergenic
919830408 1:201536894-201536916 ATGGACAGGTTGAGGGAGGAAGG - Intergenic
919862139 1:201747040-201747062 AGGGAGACTTTCAGGTATGAAGG + Intronic
920109691 1:203578712-203578734 ATGGGAGGTTTCAGGAAGGAAGG + Intergenic
920303854 1:205006436-205006458 AAGGGGAGATTCAGGGAGGAGGG + Intronic
920578208 1:207078843-207078865 ATGGGGAGGTTGAGGGAGGAGGG + Intronic
921270400 1:213463735-213463757 GGGCAGAGTTTCAGAGAGGAGGG - Intergenic
921433838 1:215092824-215092846 CTGAGGAGTTTCAGGGAGGTGGG - Intronic
921516518 1:216098904-216098926 ATGGAAAGTTTGAGGAAGGCTGG + Intronic
921609910 1:217199559-217199581 ATGGAGACTTTCCGGGTTGATGG - Intergenic
923052162 1:230396427-230396449 ATAGAGAGTGAAAGGGAGGATGG - Intronic
923276011 1:232396986-232397008 CTGGAGATTTTCAGGGAATAAGG - Intergenic
923363229 1:233233715-233233737 AAGGAGAGAGGCAGGGAGGATGG + Intronic
923371544 1:233319031-233319053 ATGGTGGGTATCAGTGAGGAGGG - Intergenic
924570765 1:245235618-245235640 AGGGAGAGAGGCAGGGAGGAAGG + Intronic
1062768019 10:80232-80254 AGGGGCAGCTTCAGGGAGGAAGG - Intergenic
1063173793 10:3533759-3533781 ATGAAGAGGATCAGGGAGGGAGG - Intergenic
1063173812 10:3533829-3533851 ATGAAGAGGATCAGGGAGGGCGG - Intergenic
1063501602 10:6560134-6560156 ATGGATATTTTCAAGGAGAAGGG - Intronic
1063514363 10:6680256-6680278 ATGGAGAGTTTCACAGTGGGGGG - Intergenic
1063701543 10:8389246-8389268 AGGGAGAGTTTCCAGGAGCATGG + Intergenic
1064632402 10:17329979-17330001 CTGGAGAGTTTCATGCAGAAGGG + Intronic
1065113701 10:22464176-22464198 ATGGAGAGAGAAAGGGAGGAAGG + Intergenic
1066449661 10:35517192-35517214 ATGGAGTTTATAAGGGAGGAAGG + Intronic
1066713887 10:38265711-38265733 ATGGAGCTGTTCAGGGAGCAGGG - Intergenic
1067027826 10:42859239-42859261 CTGGTGGGTTTCAGGGAGGCAGG - Intergenic
1067832595 10:49618953-49618975 TTGGAGAGATTCGGAGAGGAAGG + Intronic
1067948063 10:50703553-50703575 AGGGAGGGTTTCCGGGAGGAAGG - Intergenic
1068035340 10:51752467-51752489 ATGGAGAGGGTCATGTAGGAAGG + Intronic
1068159031 10:53239822-53239844 CTGCAGAGTTTCAGAGAGGAAGG - Intergenic
1068976249 10:63013328-63013350 TAGGGGAGTTTCAGGTAGGAGGG + Intergenic
1069049274 10:63775588-63775610 ATTTTGAGTTTCAGGTAGGACGG + Intergenic
1069307465 10:66988844-66988866 GTGGAGAGAAACAGGGAGGAGGG - Intronic
1069481431 10:68785760-68785782 CTGAAGAGGTTCAGGGAAGATGG - Intronic
1069608033 10:69752553-69752575 CAGGAGAGAGTCAGGGAGGATGG + Intergenic
1069857497 10:71449450-71449472 ATGGGTAGTTCCAGGGAGGCAGG - Intronic
1070791078 10:79189852-79189874 TTGGAGGGTTTCAGGAATGAGGG + Intronic
1070794919 10:79210861-79210883 ATGGAGGGCTTCCTGGAGGAGGG + Intronic
1070883373 10:79868551-79868573 AGGGAGGGTTTCCGGGGGGAAGG - Intergenic
1071183137 10:83010004-83010026 ATTGAGAGTTACAGGAAGAAAGG - Intergenic
1071562520 10:86655237-86655259 ATGGAGCCCTCCAGGGAGGAGGG + Intronic
1071649943 10:87384858-87384880 AGGGAGGGTTTCTGGGAGGAAGG - Intergenic
1072005924 10:91247198-91247220 AAGGAAATTTTCAGGGAGGCAGG + Intronic
1072232480 10:93425244-93425266 AGGGAGAGTTTCAAGGAAGCAGG + Intronic
1072330247 10:94341463-94341485 TTGGAGAGTTTTAAGCAGGAGGG - Intronic
1074541070 10:114365576-114365598 ATGGGGAGTATCACTGAGGAAGG - Intronic
1074699700 10:116082389-116082411 GTGGAAAGTCCCAGGGAGGAGGG - Intronic
1074912019 10:117920248-117920270 ATAGAGGGTTTCAAGGAGGAAGG - Intergenic
1076810982 10:132886200-132886222 ATGGAGAGTGACAGGCAGCAAGG - Intronic
1077077114 11:706826-706848 GGTGGGAGTTTCAGGGAGGAGGG + Intronic
1077902545 11:6501038-6501060 AAACAGAGTTTCAAGGAGGAGGG + Intronic
1078444851 11:11396411-11396433 ATGGAGAGCTGCAGGGATGATGG + Intronic
1078921999 11:15839407-15839429 ATGAAGAATTTTAGGGAAGATGG + Intergenic
1079505074 11:21144118-21144140 CTGGAGAGTTTCTGGGGAGAAGG + Intronic
1080253683 11:30265332-30265354 ATTGAGAGTTTCTAGGATGAAGG + Intergenic
1081301922 11:41463093-41463115 ATGGCCAGTTTCAGGGGAGAAGG - Intergenic
1081962800 11:47150738-47150760 AAGGACAGCTTCAGGGAGGATGG + Intronic
1083275269 11:61593543-61593565 AAAGAGTGTTTCAGGGAAGAGGG + Intergenic
1083453502 11:62762360-62762382 ATCGAGAGTTTGGGGGAGGAAGG + Intronic
1083589231 11:63883156-63883178 ATGGACCTTTTCTGGGAGGAGGG + Intronic
1084157190 11:67320358-67320380 ATGGTGAGCTTCTGGGAGGCAGG + Intronic
1084507034 11:69574780-69574802 AGGGAGAGTTGCAGGGAGTCGGG - Intergenic
1085434292 11:76485498-76485520 ATTGAGAGTTTCAAGCATGAAGG - Intronic
1085781537 11:79413422-79413444 ATGGAGCGTGCCAGGGAGGCGGG - Intronic
1086908144 11:92440704-92440726 AGGGAGAGTTTCAATAAGGAGGG + Intronic
1087219448 11:95530634-95530656 AAAAAAAGTTTCAGGGAGGATGG - Intergenic
1087530032 11:99368912-99368934 CTGGAGAATGTCAGGGAAGAGGG + Intronic
1088220656 11:107566691-107566713 AGTGGGAGTTGCAGGGAGGAAGG + Intergenic
1089179223 11:116569461-116569483 CTGGAGAGCTTCAGGGAGCAGGG + Intergenic
1089272955 11:117314734-117314756 TTGGAGATTGTCAGGAAGGATGG + Intronic
1090525048 11:127524700-127524722 ATGGAAAGTATCAGAGATGAGGG - Intergenic
1091078496 11:132643437-132643459 ATGCAGAGCCTCAGGGAGGCTGG + Intronic
1091233080 11:134000938-134000960 CTGGAGAGTTTCGTGGAGGGTGG - Intergenic
1091382276 12:69650-69672 AAGGAGAGCTGCAGGGATGAGGG - Intronic
1092214677 12:6672645-6672667 CTGGAGTGTTTTTGGGAGGAGGG - Intronic
1093267447 12:17020312-17020334 AGGGAGAGACACAGGGAGGAAGG - Intergenic
1094097663 12:26725891-26725913 ATGGAGAGTTGGCTGGAGGACGG - Intronic
1094291265 12:28852758-28852780 ATGAAGAGTTTCCAGAAGGAAGG - Intergenic
1094484261 12:30911889-30911911 TTGGAGAGTCTCAAGGAGGCTGG - Intergenic
1094579519 12:31721409-31721431 ATGCAGAGTGGCAGGGAGGTTGG - Intronic
1095251925 12:39989166-39989188 ATGGAGAGTTTCAGGGGGTAAGG - Intronic
1095608919 12:44104269-44104291 ATGGAGAGATGAAGGGAGGGAGG - Intronic
1095679617 12:44958822-44958844 TTGGCGTGTTTGAGGGAGGAGGG + Intergenic
1096916821 12:55041845-55041867 ATGGGAAGTATCTGGGAGGAGGG - Intergenic
1097452078 12:59749146-59749168 ATTGAGAATTTAAGGTAGGAAGG + Intronic
1099464233 12:82962954-82962976 ATACAGAGTTTCAGGAAGGAAGG + Intronic
1100401029 12:94230092-94230114 ATGGAGAATGGGAGGGAGGAGGG - Intronic
1101036602 12:100713791-100713813 AGGGAGAGTTTCATGGATCAGGG + Intergenic
1101455563 12:104826898-104826920 ATGTAAAGTGTCAGGGAAGAGGG + Intronic
1102520126 12:113472613-113472635 AGGGGGAGATTCAGGGTGGACGG + Intergenic
1102621024 12:114194381-114194403 ATGGAGAGTTGCCGAGACGAGGG + Intergenic
1102653828 12:114463216-114463238 ATGGAAGTTTTCTGGGAGGAAGG + Intergenic
1103057797 12:117835319-117835341 ATGGCGAGTTGGAGGGAGGGTGG + Intronic
1103434499 12:120914473-120914495 ATGAACAGTCTCAGGGAGAAGGG - Intergenic
1103463976 12:121127357-121127379 TTGGAGGGTTGCGGGGAGGAAGG - Intergenic
1104088094 12:125493882-125493904 ATGGCCATTTCCAGGGAGGAGGG - Intronic
1104088338 12:125494623-125494645 ATGGCCATTTTCAGGGAGGAGGG - Intronic
1104088503 12:125495112-125495134 ACGGCCATTTTCAGGGAGGAGGG - Intronic
1104088537 12:125495214-125495236 ACGGCCATTTTCAGGGAGGAGGG - Intronic
1104295197 12:127505712-127505734 AGGGAGAGTGGCAGGGAGGAAGG - Intergenic
1104519400 12:129459091-129459113 ACAGAGACCTTCAGGGAGGAGGG - Intronic
1105892723 13:24693355-24693377 ATGGAGAGGAAAAGGGAGGAAGG - Intronic
1106081819 13:26506634-26506656 ATGAAGAGTTTCAAGGGGGAGGG - Intergenic
1106644113 13:31614471-31614493 CTGGAGAGTTTCATGGGGGCTGG - Intergenic
1107143024 13:37024702-37024724 AGAGAGAGTTTTAGGGAGAAAGG + Intronic
1107964082 13:45584149-45584171 ATGGAGAATTTCTGTGAGCATGG + Intronic
1108151624 13:47541804-47541826 ATGGAGAATATGAGGGAGGGAGG + Intergenic
1108379257 13:49840902-49840924 AGGGAAAGTTCCAGGGAGCAGGG - Intergenic
1108704379 13:52972035-52972057 AGGGAAAGCTTAAGGGAGGAAGG + Intergenic
1108728363 13:53205312-53205334 ATGGAGAGTGACAGGGAGGAGGG - Intergenic
1109175581 13:59151346-59151368 ATGGAGAGTGTGAGGAGGGAGGG - Intergenic
1109507207 13:63319489-63319511 AGGAGGAGATTCAGGGAGGAGGG - Intergenic
1110620172 13:77586010-77586032 ATGGAGAGTTTCAGGGAGGAGGG - Intronic
1111947801 13:94683589-94683611 GGGAAGAGTTTCAGGAAGGAGGG + Intergenic
1112709913 13:102115682-102115704 GTGGAGAGGGTCAGGGAGCATGG + Intronic
1112877699 13:104065369-104065391 TTGGAGAGTGTCAAGAAGGATGG - Intergenic
1113032752 13:106012872-106012894 AGTGTGAGTTTCAGGGATGAGGG - Intergenic
1113462766 13:110493371-110493393 ATGGAGGGTCTCAGAGAGCAGGG + Intronic
1113853140 13:113429266-113429288 ATGGGGAGTTCCAGGGAGGATGG - Intronic
1114751163 14:25206417-25206439 ATTGAGAGTTTCTAGCAGGAAGG + Intergenic
1115124563 14:29976284-29976306 ATTGAGAGTTTTTGGCAGGAAGG - Intronic
1118375207 14:65170914-65170936 GTGGTGAGTTCCAGCGAGGAGGG + Intergenic
1118693360 14:68360986-68361008 ATGAAGGGTTTTAGGGAGAAGGG + Intronic
1118703788 14:68461205-68461227 ATTTAGACTTTCAGGGATGAAGG + Intronic
1119996050 14:79254865-79254887 AGGAAGAGTTGGAGGGAGGAAGG - Intronic
1120630939 14:86889293-86889315 ATGGAGAGTATTAGAAAGGACGG + Intergenic
1121670824 14:95709636-95709658 AGGGACAGCTTCAGGCAGGAGGG + Intergenic
1121686798 14:95841677-95841699 ATGGAGAGAGTTAGTGAGGAAGG + Intergenic
1121689474 14:95865909-95865931 ATAGAAAGTTTCTTGGAGGAAGG + Intergenic
1121917465 14:97848866-97848888 AAGGAGACCTGCAGGGAGGAGGG - Intergenic
1121924001 14:97911499-97911521 GTGGACAGTTTCAGGGAAGCAGG - Intergenic
1124594803 15:31083539-31083561 ATGGAGAGTTTCAGGCATGCAGG - Intronic
1125019883 15:34974041-34974063 ATGGAGAGTCTGAGGTAGCAGGG + Intergenic
1125324448 15:38522726-38522748 ATTGAGAAGTTCAGTGAGGAAGG + Intronic
1125338109 15:38647952-38647974 GTGGGGAGTTGCAAGGAGGAGGG + Intergenic
1127374092 15:58366860-58366882 ATTGAGAGTTTTTGGGAGAAAGG - Intronic
1128607912 15:69051061-69051083 AAGGAGAGATGCAGGGAGGAGGG - Intronic
1128940650 15:71785045-71785067 ATGGAGGGGTTCTGGAAGGAGGG + Intergenic
1129117256 15:73371356-73371378 AGGGAGGGTTTCCTGGAGGAGGG + Intergenic
1129156805 15:73723134-73723156 ATGGAGAAATTTTGGGAGGAAGG + Intergenic
1129179677 15:73866150-73866172 ATGGAGGGGTACAGGGAGGCAGG - Intergenic
1129699644 15:77760246-77760268 ATGGAGAGGCTCAAGGAGGTGGG + Intronic
1129797828 15:78391535-78391557 ATGGAGAGTTTAAGGGGGTTGGG + Intergenic
1129912371 15:79239437-79239459 ATGCACAGGGTCAGGGAGGAAGG - Intergenic
1130327720 15:82895162-82895184 AAGGGAAGTTTCAGGGAGCAAGG - Intronic
1131521272 15:93117972-93117994 ATGGTGAGCATCAGGAAGGAAGG - Intergenic
1131791645 15:95972054-95972076 ATGGAGAGATGCTGGGAGAATGG - Intergenic
1133324541 16:4935282-4935304 ATGGAGAGCTGCACGAAGGAGGG + Intronic
1133410058 16:5560842-5560864 AGGCAGAGTGTCAAGGAGGATGG - Intergenic
1133873410 16:9710759-9710781 ATGGAGAGAGTCAGAGAGGTGGG + Intergenic
1134347495 16:13404529-13404551 ATGGTGAGTTTATGGGACGAAGG + Intergenic
1135728194 16:24873232-24873254 ATGGAGAGAGGGAGGGAGGAAGG + Intronic
1135978664 16:27129122-27129144 TTGGACAGTTTCTGGGAGGAGGG - Intergenic
1136856818 16:33665740-33665762 CTGGTGGGTTTCAGGGAGGCAGG + Intergenic
1137783215 16:51115139-51115161 ATGGATAATTTCAGGGAGCCTGG - Intergenic
1139318280 16:66092049-66092071 AAGGAGAGGTGCGGGGAGGAAGG + Intergenic
1139646420 16:68334421-68334443 AGGGAGAGTTTCAAGAAGGAAGG - Intronic
1140702830 16:77598316-77598338 GAAGAGAGGTTCAGGGAGGAAGG + Intergenic
1141842641 16:86583961-86583983 ATGGAAAGGATCAGGGTGGAAGG + Intergenic
1203118391 16_KI270728v1_random:1514215-1514237 CTGGTGGGTTTCAGGGAGGCAGG + Intergenic
1143964183 17:10744910-10744932 AGGGAGAGAGACAGGGAGGAGGG + Intergenic
1144352899 17:14415809-14415831 AGGGAGAGATGGAGGGAGGAAGG - Intergenic
1144970779 17:19108201-19108223 AAGGAGGGTTTCAAGCAGGAAGG - Intergenic
1144991081 17:19234363-19234385 AAGGAGGGTTTCAAGCAGGAAGG - Intronic
1145304402 17:21665368-21665390 ATAGAGAGATTCTGGGAGGAGGG + Intergenic
1145850747 17:28093172-28093194 GAGGGGAGTTGCAGGGAGGAGGG + Intronic
1146405217 17:32530918-32530940 ATGGTGAGTTGCAGTGAGGGAGG - Intronic
1146511322 17:33451443-33451465 AAAGAGGATTTCAGGGAGGAAGG - Intronic
1147015920 17:37490972-37490994 CTGTAGAATGTCAGGGAGGACGG - Intronic
1147395734 17:40140962-40140984 ATTGGGGGTTTCTGGGAGGATGG + Intronic
1147434685 17:40402514-40402536 ATAAAGAGTTTCAAGAAGGATGG + Intronic
1147864509 17:43543936-43543958 ATGGAGAGTTCCAGGGTAGTTGG + Intronic
1148020406 17:44549466-44549488 ATGGACAGGTTCAGGGAGAGAGG + Intergenic
1148144974 17:45358431-45358453 ATGAATAGTGTGAGGGAGGAGGG + Intergenic
1148163297 17:45464166-45464188 AAGGAGAGGTGCAGGGAGTAGGG - Intronic
1148334706 17:46833438-46833460 AAGGTGAGTGTTAGGGAGGAAGG + Intronic
1148806387 17:50266162-50266184 ACCGAGAGTGGCAGGGAGGACGG - Intergenic
1148902330 17:50887766-50887788 ATGGAGAGTTGGGAGGAGGAAGG + Intergenic
1149698731 17:58637594-58637616 ATGGAGAGGTTCCTGGAGGATGG + Intronic
1151055093 17:71021653-71021675 ACAAAGAGTTTCAGGAAGGAGGG - Intergenic
1151336785 17:73444578-73444600 ATGAGGTGATTCAGGGAGGATGG - Intronic
1151405432 17:73883008-73883030 ATGTGCAGTTTCTGGGAGGAGGG + Intergenic
1151422736 17:74009195-74009217 ACGATGGGTTTCAGGGAGGAGGG - Intergenic
1151536271 17:74740675-74740697 ATGGAGAGGATCAGAGAAGAGGG - Intronic
1151842944 17:76630566-76630588 AAGAAGGGTTTCAAGGAGGAAGG - Intronic
1152332140 17:79679453-79679475 ATGGAGGGGTTCAAGGTGGAGGG - Intergenic
1153594264 18:6708456-6708478 CAGGTGTGTTTCAGGGAGGAAGG + Intergenic
1153898912 18:9597384-9597406 AGGGAGAGTATCAGAGAGGAGGG + Intronic
1155484869 18:26330739-26330761 ATGGAGAGATTAAGGGTAGAAGG - Intronic
1156283366 18:35664216-35664238 AAGGAGACTTTCAGGGGTGATGG - Intronic
1156331781 18:36129779-36129801 ACGGAGAGTCTCAGGGGGGCGGG + Intronic
1156987508 18:43365870-43365892 AGGGAGAGAGTGAGGGAGGAGGG + Intergenic
1157180713 18:45495651-45495673 ATAGAGAGGTCCAGGGAAGAAGG - Intronic
1157870387 18:51225129-51225151 ATGGAGAGTTACAGTGTTGATGG - Intergenic
1157893115 18:51437751-51437773 ATGGGGAGTTCCAGGGAGACAGG + Intergenic
1158055276 18:53271579-53271601 ATGGAGAGGTCCATGGAGCAAGG - Intronic
1158423339 18:57315056-57315078 AGGCAGAGTTTCAAGGAGGTAGG - Intergenic
1158631676 18:59120688-59120710 ATGGTGAATTTCAGTGAGGGTGG - Intergenic
1159372548 18:67546852-67546874 ATGGAGACTTTGAGGGACGATGG - Intergenic
1159632518 18:70765298-70765320 ATAGAGACCTCCAGGGAGGAAGG + Intergenic
1160718380 19:586712-586734 CTGGGGAGGTTCAGCGAGGAGGG + Intergenic
1160953159 19:1677146-1677168 ATAGAGGTTTTCAGGGACGATGG - Intergenic
1161769591 19:6223995-6224017 AGTGAGAGTACCAGGGAGGAGGG + Intronic
1163216973 19:15886123-15886145 ATTGAGGGCCTCAGGGAGGATGG + Intronic
1163397155 19:17070326-17070348 ATGGAAGGTTTCAGGAAGCAGGG - Intronic
1163512141 19:17741645-17741667 ATGGAGGGCTTCCTGGAGGAAGG + Intergenic
1163512159 19:17741710-17741732 ATGGAGGGCTTCCTGGAGGAGGG + Intergenic
1165843206 19:38801903-38801925 ATGGACAGCTGCAGGGAGAAGGG + Exonic
1166328712 19:42066646-42066668 GAGGAGAGTTACAGGGAGGCAGG + Intronic
1166760080 19:45218601-45218623 ATGGAGGGCTTCCTGGAGGAGGG + Intronic
1166879762 19:45920682-45920704 ATGGAGTGATTCAGTGAGGCTGG + Intergenic
1167017295 19:46849637-46849659 ATGCAGAGATTCAGGACGGAGGG - Intronic
1167383167 19:49150021-49150043 CTGGAGAGGAACAGGGAGGAGGG + Intronic
1167464076 19:49640960-49640982 GAGGAGGGTGTCAGGGAGGAAGG + Intergenic
1167669139 19:50839458-50839480 CTGGGGAGTCTGAGGGAGGAGGG + Intergenic
1167760748 19:51446990-51447012 AGCCAGCGTTTCAGGGAGGAGGG + Intergenic
1167779664 19:51590862-51590884 CTGACCAGTTTCAGGGAGGAAGG + Exonic
925650812 2:6087189-6087211 TTGGAATGTTTCTGGGAGGAGGG - Intergenic
925784874 2:7422144-7422166 ATGGAGAGTGTGAGGGAGCAGGG + Intergenic
926335026 2:11856693-11856715 AGGGAGAGCTTGAGGAAGGAGGG + Intergenic
926920759 2:17937469-17937491 AAGGAGGGTATCAAGGAGGAGGG - Intronic
927049808 2:19316193-19316215 TTGGAGAGTCAGAGGGAGGAGGG - Intergenic
927103132 2:19802960-19802982 GTGGAGAGTTTAATGGAGGGGGG - Intergenic
927140173 2:20124824-20124846 CTGGAGAGTGTCAGGGCGGGAGG + Intergenic
927458266 2:23276046-23276068 ATGGAGAGACTGAGGAAGGAAGG - Intergenic
927521435 2:23701108-23701130 ATGGGAAGGTTGAGGGAGGAGGG - Intronic
927639541 2:24838067-24838089 AGGGAGAGGCTCAGAGAGGAGGG - Intronic
928924452 2:36563809-36563831 AGGAAGCGGTTCAGGGAGGAGGG - Intronic
929355691 2:41021671-41021693 ATGGAGGCATTCAGTGAGGAGGG - Intergenic
929747295 2:44672070-44672092 ATGGGGAGGGTCAGGGAGAATGG - Intronic
930912144 2:56641815-56641837 GGGGAGAGGTTCAGGGAGAATGG + Intergenic
931264631 2:60649809-60649831 AGGGAGAGTTGGAGGGAGGGAGG + Intergenic
932409299 2:71535677-71535699 GAGCAGAGCTTCAGGGAGGATGG + Intronic
933283779 2:80361769-80361791 ATGGAGAGGTTTTGGGGGGAAGG - Intronic
934578490 2:95418600-95418622 GTAGAGAGCTTCAGGAAGGAGGG + Intergenic
934600954 2:95658113-95658135 GTAGAGAGCTTCAGGAAGGAGGG - Intergenic
934853610 2:97716076-97716098 ATGGAATGCTTCTGGGAGGATGG + Intronic
936534326 2:113300262-113300284 GTAGAGAGCTTCAGGAAGGAGGG - Intergenic
936730145 2:115373095-115373117 AGGGAAAGTTTCCTGGAGGATGG + Intronic
937080763 2:119137952-119137974 AGGGAGGGTTTCCTGGAGGAGGG + Intergenic
937659668 2:124416198-124416220 ATTGAGAGTTGGAGTGAGGAGGG + Intronic
937892378 2:126948466-126948488 ATGTAGAATGTCAGGGTGGAAGG - Intergenic
938765381 2:134457717-134457739 ATGAAGACTGTCAGAGAGGAAGG + Intronic
938786664 2:134636060-134636082 ATTGAGAGTTCCATGGGGGAAGG - Intronic
938954025 2:136282175-136282197 AGGGAGAGTCCCAGGGAAGAAGG + Intergenic
939481346 2:142751534-142751556 CTGGAAACTTTTAGGGAGGATGG - Intergenic
939516137 2:143170535-143170557 AGGGAGAGTTTCAGGGCTTAGGG - Intronic
939534381 2:143408375-143408397 GTCCAGAGTTTCAGTGAGGAAGG - Intronic
940041883 2:149369688-149369710 AGGGAGAGATTCAAAGAGGAGGG + Intronic
940502711 2:154514318-154514340 ATAAAGAGTTTAAAGGAGGAGGG + Intergenic
940885300 2:158984709-158984731 GGGGAAAGCTTCAGGGAGGAGGG + Intronic
941092211 2:161190829-161190851 ATACAGAGTTTCAGTTAGGAAGG + Intronic
941763024 2:169265319-169265341 CTGGTGAGCTTCAGGCAGGAAGG - Intronic
942139863 2:172967169-172967191 ATGCAGAGTGTCAGGCAGGAGGG - Intronic
942607695 2:177709760-177709782 AGAGAGAGTTTCAGGAAGGAGGG + Intronic
942616410 2:177795811-177795833 ATGCAGAGTCTTAGGGAGGTGGG - Intronic
942635334 2:177998010-177998032 ATGGACAGTTTTAGAGAAGAAGG + Intronic
944517965 2:200531389-200531411 ATGGGAATTTTTAGGGAGGAGGG + Intronic
944635254 2:201670119-201670141 ATGGAGAGAGGGAGGGAGGAAGG + Intronic
945703567 2:213201003-213201025 ATGGAGAATTCCTGGGATGAGGG + Intergenic
946642435 2:221799193-221799215 ATGTACACTTTCAGGGAGGAGGG - Intergenic
947451067 2:230209475-230209497 AAGGAGAGGATCAGGGAGGAAGG + Intronic
948896784 2:240931345-240931367 AGTGAGGGTTTCAGGGAGCACGG + Intronic
1169274462 20:4224320-4224342 AAGGAGAGTGCCAGGGAGGATGG + Intronic
1169602216 20:7274579-7274601 AGGGAGAGATTCTGGGAGGTAGG + Intergenic
1169947133 20:11001207-11001229 AGGAAAAGTTTCAGGAAGGAGGG - Intergenic
1170145158 20:13165344-13165366 ATGGGAAGTTCCAGGCAGGAGGG + Exonic
1170407361 20:16052432-16052454 ATGAAGAGTTACAGGAGGGAGGG + Exonic
1170459617 20:16564962-16564984 ATGGAGAGAGGAAGGGAGGAAGG - Intronic
1170764622 20:19279501-19279523 AAAGAGAATTTCAGGAAGGAAGG - Intronic
1171105957 20:22432551-22432573 GTGGAGAGTGCTAGGGAGGAAGG + Intergenic
1171209047 20:23302904-23302926 ATGGAGAGGTTGAAGGAGAAGGG + Intergenic
1171521921 20:25782800-25782822 ATAGAGAGATTCTGGGAGGAGGG + Intronic
1171554904 20:26073083-26073105 ATAGAGAGATTCTGGGAGGAGGG - Intergenic
1172012932 20:31856921-31856943 TGGGAGTGTTTCAAGGAGGAGGG + Intronic
1172097678 20:32468234-32468256 ATGGAAGGGTTCTGGGAGGATGG - Intronic
1172969156 20:38861001-38861023 ATGGGGAGAATCAGGGAAGATGG - Intronic
1173137421 20:40451520-40451542 CTTGGTAGTTTCAGGGAGGATGG - Intergenic
1173268649 20:41511089-41511111 ATGGAAAGTAGCAGGGAGCAGGG - Intronic
1173313548 20:41922407-41922429 ATGGAGGTTTTCATGCAGGAAGG - Intergenic
1173393358 20:42655063-42655085 ATGGACCTTTTCAGGGTGGAAGG - Intronic
1173448716 20:43143264-43143286 CTGGAAAGTTGAAGGGAGGAGGG - Intronic
1173666124 20:44764250-44764272 TTGGTGAGTTTGTGGGAGGATGG - Intronic
1173840820 20:46155805-46155827 ATGGAGAGCTTCAGGAAGGCAGG + Intergenic
1174508075 20:51029812-51029834 TTGGAGAGAGTCAGGCAGGAGGG + Intergenic
1175220254 20:57412558-57412580 AAGGTGAGGTTCAAGGAGGATGG - Intergenic
1175223523 20:57431801-57431823 ATGTTGAGGTCCAGGGAGGAGGG + Intergenic
1175382676 20:58574641-58574663 ATGGAGAGATAGATGGAGGAAGG - Intergenic
1175480032 20:59304131-59304153 CTACAGAGTTTCAGGAAGGAAGG - Intronic
1175935126 20:62510636-62510658 ATGGAGAGGTGGAGGGTGGAGGG - Intergenic
1175984034 20:62755356-62755378 ATGGAGGGATGAAGGGAGGAAGG - Intronic
1176110278 20:63407754-63407776 CTGGAGAGGTACAGGGAGGGGGG + Intronic
1176655729 21:9587796-9587818 ATAGAGAGATTCTGGGAGGAGGG + Intergenic
1177475805 21:21620469-21620491 ATTGAGAGTTCCAGAGAGGAGGG + Intergenic
1177874859 21:26619601-26619623 AATGAGAGTGTCAAGGAGGAGGG - Intergenic
1178072443 21:28983655-28983677 ATGGAGAGCCACAGGAAGGATGG + Intronic
1178369493 21:32015739-32015761 ATGGAAGGTTTAAGGAAGGAAGG - Intronic
1178661434 21:34510650-34510672 AAGGAGAGTTTCAAGGAGGCAGG - Intergenic
1178900203 21:36592435-36592457 ATGGAGAGAAGCAGGGAGTAGGG - Intergenic
1179262055 21:39766019-39766041 AGGGAGAGCATGAGGGAGGAAGG - Intronic
1180946337 22:19695815-19695837 ATCATGAGTTTCAGCGAGGAGGG + Intergenic
1181149568 22:20873555-20873577 ATGGAGAGGTTCAGGCATGGTGG + Intronic
1181537066 22:23551895-23551917 ATGGAGAATGGCTGGGAGGATGG - Intergenic
1181687510 22:24539735-24539757 ATGATGTGTTTGAGGGAGGATGG + Intergenic
1181790631 22:25263022-25263044 TGGGAGAGTTGCAGGGAGGGGGG - Intergenic
1182579844 22:31300270-31300292 GGAGAGTGTTTCAGGGAGGAGGG + Intergenic
1182602348 22:31475956-31475978 GGGGAGGGGTTCAGGGAGGATGG + Intronic
1183164601 22:36138443-36138465 ATGGAGAGTTACAGGGACTGAGG + Intergenic
1183170903 22:36187593-36187615 ATGGAGAGTTACAGGGACTGAGG + Intergenic
1183517677 22:38276584-38276606 ATGGGTAGTTGCATGGAGGAGGG - Intergenic
1184480909 22:44746341-44746363 ATGGAGAATTTCAAGGAGGAGGG - Intronic
1185212891 22:49581790-49581812 ATGGAGAGATTAAGGGATGGAGG - Intronic
950634325 3:14304244-14304266 TTGCAGAGTCACAGGGAGGACGG - Intergenic
950870722 3:16226170-16226192 ATGATTAGTTTCTGGGAGGAGGG + Intronic
950900250 3:16491181-16491203 AAGGAAAGTTTCAGAGAGAAGGG + Intronic
951481493 3:23166809-23166831 TTGGAGGGTTTCAGGGAGAAAGG - Intergenic
951677746 3:25261302-25261324 ATAGAGAGTTTCAAGAAGAAGGG - Intronic
952460603 3:33521681-33521703 ATTGAGAGATTCTGGGAAGATGG + Intronic
953167935 3:40482026-40482048 AAGCTGAGTTTCAGAGAGGAAGG - Intronic
953540479 3:43813556-43813578 AGGGAGAGTGGCAGGGAGGGGGG - Intergenic
954131622 3:48564027-48564049 ATGGGGGGTTTCAAGGGGGAAGG - Intergenic
954329484 3:49881950-49881972 TTGGATAGCTCCAGGGAGGAAGG - Intergenic
954460288 3:50622762-50622784 ATGGAGAATTCCTGGGAGAAAGG + Intronic
955203590 3:56875299-56875321 AATCAGAATTTCAGGGAGGAAGG - Intronic
955539543 3:59959941-59959963 ATGTAGAGGTTCATGGAGGAAGG + Intronic
955602989 3:60668236-60668258 AGGGAGAGTCTCAGGGCTGAGGG + Intronic
958411343 3:93820315-93820337 ATGGAAAGCTTCAAGGAGGAAGG - Intergenic
960168472 3:114431037-114431059 ATGGAGGGGCACAGGGAGGAGGG - Intronic
960610495 3:119550923-119550945 ATGGAGGGGGGCAGGGAGGATGG - Intronic
961084955 3:124059031-124059053 AATGAGAGTCTCAGGAAGGAAGG - Intergenic
961821450 3:129577611-129577633 ATGGCGAGTTCCAGGGAGGTGGG + Intronic
962899048 3:139741258-139741280 ATGGAGATTTTCAGATAGGTGGG + Intergenic
963473698 3:145776564-145776586 AGGGAGAGAAACAGGGAGGAAGG - Intergenic
963854275 3:150238012-150238034 ATGGAGACTGGCACGGAGGAGGG + Intergenic
963901353 3:150736246-150736268 CTGGAAAGTTTCAAGGAGCATGG - Intergenic
964656106 3:159067521-159067543 TTGGAGTCTTTCAAGGAGGAAGG - Intronic
964958717 3:162395510-162395532 ATGGTAAGTTTAAGGGAGAATGG - Intergenic
965125682 3:164626585-164626607 ATGAAGGTTTTCAGGGAAGAAGG - Intergenic
965465993 3:169031333-169031355 AAGGAGAGTTTCAGGAAAAAGGG - Intergenic
965523493 3:169692227-169692249 ATGGAGGGTTTCACTGAGGAGGG + Intergenic
965659027 3:171021287-171021309 ATGGAGAGTATGAGGGAAGTGGG - Intronic
965700002 3:171450971-171450993 TTGGACAGTTTCAGGGTGGAAGG + Intronic
965784555 3:172322167-172322189 ATCTAGAGTTTCAGCGAGGAGGG + Intronic
965922258 3:173931374-173931396 ATGGAGGGTTACAGGGTGGAGGG + Intronic
966646605 3:182252512-182252534 CTGGAGAGGTGGAGGGAGGAAGG + Intergenic
967060249 3:185865947-185865969 GTGTAGAGTTTCCAGGAGGAGGG + Intergenic
967717879 3:192784038-192784060 AAGGAGAGTGTCAAGGGGGAGGG + Intergenic
968088746 3:195886573-195886595 TTAGAGAGGGTCAGGGAGGAGGG + Intronic
968125628 3:196157973-196157995 ATAGAGAGTTACAGGGATCATGG - Intergenic
968136480 3:196223456-196223478 ATGGAGATTTTCACGGAGCAGGG + Intronic
968232480 3:197011943-197011965 AGGGAGAGGTGCAGGGAGGGAGG - Intronic
968265407 3:197359113-197359135 ATGGAGAGGTTCACGCAGTAAGG + Intergenic
968492145 4:895733-895755 TTGGAGAGATGCAGGGATGAGGG + Intronic
969241706 4:5902998-5903020 ATGCAGAGGCCCAGGGAGGAAGG - Intronic
969256529 4:6005918-6005940 ATGGAGAGATTGGGGGAAGAAGG + Intergenic
969305958 4:6326454-6326476 AAGGAGAACTTCATGGAGGAGGG + Intronic
969643645 4:8413492-8413514 ATGGAGGGTTGCGGGGTGGAGGG - Intronic
970456521 4:16227918-16227940 ATAGAGAATTTCATGGAGGATGG - Intergenic
970899777 4:21145320-21145342 ATTCAGAGTTTCATGGAGGTGGG + Intronic
971108673 4:23557164-23557186 ATGCAGACTCTCAGTGAGGAAGG + Intergenic
971130600 4:23805167-23805189 TTGGAGAGTCTCAGAGAAGAAGG - Intronic
971481300 4:27117241-27117263 ATGGAGAGTATAAGTGAGGTCGG - Intergenic
971766405 4:30837584-30837606 GTAGAGTGTTTGAGGGAGGATGG + Intronic
971775448 4:30958112-30958134 ATGGAAAGAATCAGTGAGGAAGG + Intronic
971819360 4:31531089-31531111 AGGGAGAGTTGCATGGAGTATGG - Intergenic
972090734 4:35279192-35279214 AAAGAGAGTTTCAAGGAGGATGG - Intergenic
972488387 4:39563668-39563690 ATGGAGATTTTTATGGAAGAGGG - Intronic
972617436 4:40713288-40713310 ATGCAGAGTTGGAGGGAGGCAGG + Intergenic
972664525 4:41151498-41151520 AAGGAGAGATTCCAGGAGGAAGG - Intronic
974660251 4:64879174-64879196 AAGGAGAGATAGAGGGAGGAGGG - Intergenic
974820377 4:67060167-67060189 ATAGAGAGTTACAGGGAAGAGGG + Intergenic
974920683 4:68235467-68235489 AGGGAGGGATGCAGGGAGGAGGG - Intronic
975105077 4:70558329-70558351 TTGGAAAGTTTCAGGGAGGAAGG + Intergenic
975442547 4:74428594-74428616 AGGGAGAGTTTAAGGGAGTAGGG - Intergenic
976100029 4:81551398-81551420 CTGTAGATTTTCAGGGAGAAAGG - Intronic
976883137 4:89954786-89954808 ATGGAGAATTTCTGGGACAAAGG + Intergenic
977103725 4:92852668-92852690 ATGGGGACTTTCAAGAAGGAGGG - Intronic
977148693 4:93480890-93480912 CTGTAGAGATTCAGGGAGGTGGG - Intronic
977382143 4:96289097-96289119 ATGGAGAGTTACAGTCAGCAAGG + Intergenic
977393150 4:96439141-96439163 TTGGAGAGTGTCATGAAGGAAGG - Intergenic
977927678 4:102719358-102719380 ACGGCGATTTTCAGGGAAGAAGG - Intronic
978106654 4:104910808-104910830 ATTGATATTTTCAGAGAGGAAGG - Intergenic
978277364 4:106968004-106968026 ATGGAGAGATGAAGGCAGGAAGG + Intronic
978604053 4:110459873-110459895 ATGGAGAGTTTTAAGCAGGAGGG + Intronic
978728473 4:111998006-111998028 ATGGCAAGTGTCAAGGAGGAAGG + Intergenic
978818971 4:112943336-112943358 ATGGAGAGAGGCAGGGAGGGAGG - Intronic
979753724 4:124312772-124312794 AGAGAGAGTGTCAGGCAGGAGGG - Intergenic
979863073 4:125718596-125718618 ATGGAGAGATGCACAGAGGAAGG - Intergenic
980133849 4:128841868-128841890 AGGGAGTATTTCAGGCAGGATGG + Intronic
980499482 4:133629836-133629858 ATGTAGAGTATGAGGGAGAAAGG + Intergenic
980645561 4:135638124-135638146 ATGCAATGTTTCAGGGAGGGAGG + Intergenic
982651287 4:158090252-158090274 ATGGAGAGTTTGAGCCAAGATGG - Intergenic
983246611 4:165295010-165295032 AGGGAGAGAGTCAGGGAGGCAGG - Intronic
983966880 4:173823420-173823442 ATGCAGAGGCTCTGGGAGGACGG + Intergenic
985166038 4:187095323-187095345 ATGGTTAGTTTCAAGGCGGATGG + Intergenic
986531110 5:8737986-8738008 AAGAAGAATTTCAGGAAGGAAGG + Intergenic
989437693 5:41433989-41434011 ATGGAGACTTTCAGCAGGGATGG + Intronic
990014668 5:51045124-51045146 TTGGAAAGTTTCAGGCAAGATGG + Intergenic
990393884 5:55355837-55355859 ATGTAGAGAGTCAGGGAAGAAGG + Intronic
990467168 5:56081397-56081419 AAGGAGAGTTTCAGGGTGGAGGG - Intergenic
990788571 5:59451175-59451197 AAGGAGTGTTTCAGAAAGGAGGG - Intronic
991052488 5:62288024-62288046 AAGGAGACTTTAAGGGAGAAGGG - Intergenic
992246390 5:74828482-74828504 ATGGAGACTTTCAGGTATGGTGG - Intronic
993021974 5:82603071-82603093 ATGGAGAGTTTCCGGAGGGTAGG - Intergenic
993078567 5:83267632-83267654 CTGGACAGTCTCAGGGAGCAGGG + Intronic
996288957 5:121829110-121829132 ATGCAGATTTTCAGGGAAGTGGG + Intergenic
996758139 5:126956777-126956799 ATGGAAACTTTTAGTGAGGAAGG - Intronic
997452019 5:133991377-133991399 CTGAAGAGTTACAGGGAGGAAGG - Intronic
997739367 5:136240141-136240163 TTGGAGAGCTTCACGTAGGAAGG - Intronic
997870750 5:137503291-137503313 GTGGAGGGTTGCAGGGAGGGTGG - Intronic
998145290 5:139724437-139724459 ATGGATGGTTTGAGGTAGGATGG - Intergenic
998457243 5:142282797-142282819 AGGAAGAGTTCCAGGGAGGCGGG + Intergenic
998754318 5:145359355-145359377 AGGGAGAGATTAATGGAGGATGG - Intergenic
998823036 5:146073992-146074014 ATGGAGAGTTTCATGGACAGGGG - Intronic
999198042 5:149796160-149796182 ATGGAGAGTGTGACGGAGTAGGG + Intronic
999644676 5:153705944-153705966 GTGAAGAGTTTGAGGAAGGACGG + Exonic
1000209803 5:159098599-159098621 ATGGAGAGAGGAAGGGAGGAAGG + Intronic
1000335021 5:160235687-160235709 CTGGAGAGCTTCAGGGAGGAGGG - Intronic
1000446696 5:161331069-161331091 AGGGAGAGTTTCCCGGAGGTGGG + Exonic
1000706645 5:164521057-164521079 GTGGTGAGGTACAGGGAGGATGG - Intergenic
1001308165 5:170590852-170590874 ATGGGGAGCTTCAGGATGGAAGG - Intronic
1002209540 5:177589005-177589027 ATGTAGAGGTTCAGTCAGGATGG - Intergenic
1002338727 5:178500061-178500083 GTGGGGAGGTACAGGGAGGAAGG + Intronic
1002401284 5:178992760-178992782 AGGGGGAGTTTCTGGAAGGAGGG + Intronic
1002584332 5:180232571-180232593 GTGGGGGTTTTCAGGGAGGAGGG - Intergenic
1004397994 6:15263136-15263158 ATGGAGAGTGACAGGCAGTAAGG - Intronic
1005604923 6:27467168-27467190 TAGGAGAGTTTCATGGAGGATGG - Intronic
1005844270 6:29765490-29765512 ATGGAGTGTCTGAGGGAGGAGGG - Intergenic
1005856375 6:29866282-29866304 ATGGAGTGTCTGAGGGAGGAGGG - Intergenic
1005906301 6:30263798-30263820 AAGGAGGGATGCAGGGAGGAAGG + Intergenic
1006206330 6:32346425-32346447 ATGGTGTGTTTTAGGGAGTAAGG - Intronic
1006269185 6:32950817-32950839 AGGGTGAGGTTCAGGGAGGTGGG + Intronic
1006402520 6:33826085-33826107 AAGGAGAGGTGAAGGGAGGAGGG - Intergenic
1006798880 6:36747008-36747030 CTGGCGAGTGACAGGGAGGAGGG - Intronic
1006947039 6:37791540-37791562 GTGCAGAGTTACAGGGAGGAGGG + Intergenic
1007354086 6:41297767-41297789 ATGGTGATTTTCAGGGAACAAGG - Intergenic
1007589980 6:43015107-43015129 ATAGAGAATATAAGGGAGGATGG + Intronic
1009048300 6:58252988-58253010 AAGAACAGTTTCACGGAGGAGGG - Intergenic
1009224171 6:61007768-61007790 AAGAACAGTTTCACGGAGGAGGG - Intergenic
1009629394 6:66173984-66174006 AAGGACAGTTTCATGGGGGAAGG + Intergenic
1010304037 6:74296398-74296420 ATGAAGAGTTTCAAGGAAAAGGG - Intergenic
1010452869 6:76022149-76022171 ATCGAGAATTTCATTGAGGAGGG + Exonic
1010489282 6:76453740-76453762 ATACAGAGTTTCAAGGATGATGG - Intergenic
1012319279 6:97822902-97822924 AAGGAGAGTTTCATGGAGGGAGG + Intergenic
1012462697 6:99481655-99481677 TGGGAGAGATTGAGGGAGGAAGG - Intronic
1012929965 6:105306589-105306611 GAGAAGAGTTTCAAGGAGGATGG - Intronic
1013013092 6:106137119-106137141 ATGGAGAGTTGCAGCGGGGAGGG - Intergenic
1013628849 6:111965154-111965176 AAGGAGAGATGAAGGGAGGAAGG + Intergenic
1014228999 6:118881321-118881343 ATGGAAAGTTTCAAGGAGGAAGG - Intronic
1015280032 6:131423187-131423209 AAGGAGAGTTTCAGAAAGGGAGG - Intergenic
1015705247 6:136080857-136080879 ATGGAGAGCTGCATGGAGGAAGG + Intronic
1015927425 6:138324050-138324072 ACGGAGAGCTTCAGCGGGGAAGG + Exonic
1016064070 6:139661038-139661060 ATCAAGACTTTCAGGGAGGTTGG + Intergenic
1016152210 6:140755503-140755525 ATTGAGAATTTCAGAGAGGGTGG - Intergenic
1016411692 6:143790024-143790046 AAGGACTGTGTCAGGGAGGACGG + Intronic
1016837287 6:148491021-148491043 AAGGAAAGTTTCAGAGAGCAAGG - Intronic
1018341821 6:162858873-162858895 ATGGCCTGTTTCAGGGAAGAAGG + Intronic
1019165214 6:170094053-170094075 AAGGTGAGTTTCTGGGAGCAGGG - Intergenic
1019320699 7:414186-414208 AGGGAGAGGATCAAGGAGGAGGG - Intergenic
1019320733 7:414264-414286 AGGGAGAGGATCAAGGAGGAGGG - Intergenic
1019388008 7:769387-769409 ATGGAGACTTACAGGGAGGCGGG + Intronic
1019889527 7:3935152-3935174 ATGGTGAGTGCCAGGGACGATGG + Intronic
1020004624 7:4775780-4775802 AGGGAGAGATGCAGGAAGGAGGG - Intronic
1020070464 7:5223756-5223778 ATGGGGAGTGTGAGGGACGAGGG - Intronic
1020441160 7:8218300-8218322 ATGGAGAAGTTCAGGAAGGTAGG - Exonic
1021301982 7:18984491-18984513 ACAGAGAGTGTCATGGAGGAGGG + Intronic
1022804253 7:33806070-33806092 AGGGAGAGTTTCAAGGAGCCAGG + Intergenic
1023416224 7:39935508-39935530 TTGCAGAGGTTCAGGGAGGAAGG - Intergenic
1023730495 7:43187141-43187163 ATGGAGAGGTCCAGGTAGCAAGG - Intronic
1024217119 7:47256928-47256950 ATGGAGACGGTGAGGGAGGAGGG + Intergenic
1024284452 7:47744966-47744988 AAGCTGAGTCTCAGGGAGGAGGG + Intronic
1024742634 7:52371589-52371611 ATTAAGAGTTTCGGGCAGGATGG - Intergenic
1024835698 7:53515541-53515563 ATGGAGTGTTCCAGGCAGGTGGG + Intergenic
1025988064 7:66473520-66473542 ATAGAGAATTTCATGGAGGATGG + Intergenic
1026150832 7:67787041-67787063 AGGGAGAGAGTCAGGGAGGGAGG - Intergenic
1026316847 7:69234570-69234592 ATGTAGAATTTCTGGGAGTAGGG + Intergenic
1027211049 7:76149417-76149439 ATAGAGAATTTCATGGAGGATGG + Intergenic
1027411668 7:77926453-77926475 ATAGAGTGTTTGTGGGAGGAGGG - Intronic
1028384716 7:90242142-90242164 ATGAAGAATTTCACTGAGGAGGG + Intergenic
1028449044 7:90959534-90959556 ATGGAGAATAGCAGGGAGGCAGG + Intronic
1029415775 7:100442276-100442298 AGGAAGAGATCCAGGGAGGAGGG + Intergenic
1029562815 7:101314637-101314659 ATGGAGAGTTCCACGAAGGTGGG + Exonic
1030014200 7:105201975-105201997 ATGAAGAGTAAGAGGGAGGATGG + Intronic
1030246709 7:107390855-107390877 ATGTAGGGTTTCAGTCAGGATGG + Intronic
1030360253 7:108588037-108588059 ATGGAGAGTGTGAGGGAGGAGGG - Intergenic
1030984800 7:116229181-116229203 AGAGAGAGTGGCAGGGAGGAAGG - Intronic
1031192771 7:118575802-118575824 CTGGGAAGTTTCAGGAAGGAAGG + Intergenic
1031598438 7:123673928-123673950 GTGGAGTCTTTGAGGGAGGAGGG - Intergenic
1032100508 7:128972687-128972709 GTGGGGGGTTTCAGGGAAGAAGG + Intronic
1032539680 7:132692813-132692835 AGGCAGAGGATCAGGGAGGATGG - Intronic
1032793122 7:135257055-135257077 ATCAAGAGTGTCAGGGAGGTGGG - Intronic
1033402146 7:141036398-141036420 ATTGAGAGTTTCTGGCATGAAGG - Intergenic
1033433186 7:141307627-141307649 ATGGGGAGAGTCAGGGAGAACGG - Intronic
1033673606 7:143516283-143516305 ATGGAGAGTTCCATGGTGGGAGG - Intergenic
1034060461 7:148082580-148082602 AGAGAGAGCTTCAGGGAGGTGGG + Intronic
1034129432 7:148701343-148701365 CTGGGGTGTTTCAGGGAGAAGGG - Intronic
1034499524 7:151440585-151440607 AGGGAGAGTGCCAGGGAGGGAGG - Intronic
1035080570 7:156212631-156212653 ATGCAGATTTTCATGGAGGTAGG + Intergenic
1035761533 8:2072309-2072331 ATGGAGGCTTTCAGGGCCGAAGG - Intronic
1036194499 8:6702016-6702038 GTGAAGAGTTGCAGGGAGAAGGG - Intergenic
1036279888 8:7391713-7391735 AAGGAGAGTGGAAGGGAGGAAGG - Intergenic
1036341633 8:7920170-7920192 AAGGAGAGTGGAAGGGAGGAAGG + Intergenic
1036961205 8:13246185-13246207 ATGGCGAGTTAAAGGCAGGAAGG + Intronic
1037286020 8:17301318-17301340 AGAGTAAGTTTCAGGGAGGAAGG + Intronic
1037573092 8:20175211-20175233 ATGGAGATGTTCAGGGAGCAAGG - Intronic
1037988141 8:23302376-23302398 AGGGAGGGCTTCATGGAGGAAGG - Intronic
1038896339 8:31786803-31786825 ATACAGAGTTTCCTGGAGGACGG - Intronic
1038896888 8:31793882-31793904 ATGGAGAGATGGAAGGAGGAAGG - Intronic
1039662492 8:39482476-39482498 ATGGAGAGTGTCAGTGAGACAGG - Intergenic
1041070620 8:54124613-54124635 AAGGAGAGTTTCAGGGTGGAGGG - Intergenic
1041730001 8:61053426-61053448 ATGTAGTGTTTCAAGGAGGAGGG + Intergenic
1041800472 8:61792460-61792482 CTGGAGTGTTTCAGGGAAAAAGG + Intergenic
1042051227 8:64710210-64710232 ATTGAGAGTTTCAGAGAGGATGG - Intronic
1042149598 8:65767703-65767725 ATGTAGAGTTTCTTGGAGGGTGG + Intronic
1042369736 8:67977811-67977833 ATGTAGAGTTTCCTGGAGGGTGG + Intronic
1043095771 8:75970191-75970213 ATGCAGAAACTCAGGGAGGAGGG - Intergenic
1044818984 8:96143424-96143446 ATGGTGGGCCTCAGGGAGGATGG - Exonic
1044896060 8:96892509-96892531 TTGGAAAGTTTCAGGGGGGTGGG + Intronic
1045485502 8:102628064-102628086 GTGGAGGGTTTCATAGAGGAAGG + Intergenic
1045499843 8:102736791-102736813 ATGGGTAGTTCCAGGGAAGAAGG - Intergenic
1046149443 8:110203190-110203212 ATGGAGAGTTTATGAGAGGCAGG + Intergenic
1047526555 8:125638813-125638835 AGGCAGGGCTTCAGGGAGGAGGG + Intergenic
1047886331 8:129253993-129254015 AAGGAGAGATTGAGGGAGGTAGG - Intergenic
1048084384 8:131161204-131161226 GTGGAGAGTTGGTGGGAGGAGGG - Intergenic
1048164717 8:132052226-132052248 ATGTAGACTTTCAGGCAGGGAGG + Intronic
1048365666 8:133736281-133736303 AGGGAGAGATGGAGGGAGGAAGG - Intergenic
1048488230 8:134868215-134868237 ATGGAGAGCTTGAGAGGGGAAGG + Intergenic
1048949029 8:139477795-139477817 AGGGAGAGATGAAGGGAGGACGG - Intergenic
1049473867 8:142788010-142788032 AGGGAGAGATGCCGGGAGGAAGG - Intergenic
1050106006 9:2167582-2167604 CTGAAGAGTGTCAGGGAGGCAGG - Intronic
1050282991 9:4071737-4071759 ATTGTGTGTTTCAAGGAGGATGG - Intronic
1050406151 9:5310366-5310388 GGGGAGAGGTACAGGGAGGAAGG - Intergenic
1051822170 9:21181135-21181157 ATGGGGATTCTCAGGGAAGAGGG - Intergenic
1051825224 9:21211733-21211755 ATGGGGATTCTCAGGGAAGAGGG - Intronic
1052252466 9:26415035-26415057 ATGGGGAGACTCAGGAAGGAAGG - Intergenic
1052287416 9:26802147-26802169 ATGGTGAGTGGCAGGGAGGGAGG - Intergenic
1052294153 9:26879026-26879048 AGGAAGAGATTCAGGGAAGAAGG - Intronic
1053278753 9:36802813-36802835 ATGAAAAGGATCAGGGAGGAGGG + Intergenic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1058190327 9:101906968-101906990 AGGGAGAGGTTTAGAGAGGAAGG + Intergenic
1058718034 9:107739721-107739743 GTGGAGGCTTTCAGGGAGCACGG + Intergenic
1060009165 9:120028233-120028255 ATGGAGAGTTCCAGGAAGTGGGG + Intergenic
1060054182 9:120399713-120399735 AGACAGAGTATCAGGGAGGAAGG - Intronic
1060122673 9:121009479-121009501 AGGGAGAGTTCCAGGAAGGAGGG + Intronic
1060202300 9:121658408-121658430 CTTGACAGTTGCAGGGAGGAGGG + Intronic
1060688257 9:125631911-125631933 ATGGTGAGTTTCTTAGAGGAAGG - Intronic
1060900245 9:127250680-127250702 GTCGAGATTTTCAGGGAGGGAGG + Intronic
1060934822 9:127508750-127508772 AAGGAGAGCTTCCTGGAGGAAGG + Intronic
1061036921 9:128119101-128119123 ATGGAGAGGTACAGGGATGGAGG + Intergenic
1061412936 9:130430939-130430961 AGGGAGATTTTCAGGGGTGAAGG + Intronic
1062250316 9:135590630-135590652 AAGGAGAGGTCCAGGAAGGAGGG + Intergenic
1062408060 9:136407178-136407200 ATGGAGAGTCTCTGGGAGACAGG - Exonic
1203633446 Un_KI270750v1:91257-91279 ATAGAGAGATTCTGGGAGGAGGG + Intergenic
1186000972 X:5010077-5010099 ATGGAGAGGTTGAGAAAGGAAGG + Intergenic
1186143038 X:6597157-6597179 ATGGAAATTAACAGGGAGGATGG + Intergenic
1186407712 X:9318208-9318230 TTGGTGACTTCCAGGGAGGATGG + Intergenic
1187378470 X:18778776-18778798 ATGGAAGATTCCAGGGAGGATGG - Intronic
1188453275 X:30332240-30332262 GTGGAGAGTCTCAGGGAAGTGGG + Intergenic
1190783853 X:53624636-53624658 ATGATGTGTTTCAGGGAGGTAGG + Exonic
1193065933 X:77260048-77260070 ATTGAGAGTTTCTAGGATGAAGG - Intergenic
1193817819 X:86125430-86125452 TTGGAGATTTCCAGGGAAGAGGG + Intergenic
1193909953 X:87292096-87292118 ATGGAGATATTCAGGGAAGGAGG - Intergenic
1195322286 X:103729537-103729559 AAGGAAAATTTCAGGGAGGGGGG - Intergenic
1195510147 X:105706449-105706471 GTGGAAAGTTCCAGTGAGGAAGG + Intronic
1195727246 X:107931227-107931249 ATGGAGAGTGTCAGGCAGGTAGG + Intergenic
1196045406 X:111251199-111251221 ATGGAGAGTTTTGGTGAGGAGGG - Exonic
1196275042 X:113756799-113756821 ATGGAGATATTCTGGGAGCATGG + Intergenic
1196848398 X:119915035-119915057 ATGGAAAGTTTCATGGAGCGGGG - Intronic
1197206846 X:123798250-123798272 AGAGAGTGTTTCATGGAGGAAGG - Intergenic
1197209293 X:123815961-123815983 AGAGAGCGTTTCATGGAGGAAGG + Intergenic
1197953682 X:131923782-131923804 ATGCAGGGTGTCAGGGAGGTGGG - Intergenic
1199440296 X:147860194-147860216 AAGGAGTGATTCAGGGAGGTGGG - Intergenic
1200158723 X:153993176-153993198 ATGGAGAGCTTCAAGCAGCAGGG - Intergenic
1200337061 X:155361986-155362008 CTGGAGAGTTTTAGGGAGAGTGG + Intergenic
1200349409 X:155479241-155479263 CTGGAGAGTTTTAGGGAGAGTGG - Intergenic