ID: 1110621522

View in Genome Browser
Species Human (GRCh38)
Location 13:77601009-77601031
Sequence TTATTAACAAGCCTGTGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 155}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110621522 Original CRISPR TTATTAACAAGCCTGTGTGA TGG (reversed) Intronic
900686072 1:3948433-3948455 CTAATAAGGAGCCTGTGTGACGG - Intergenic
902853195 1:19178005-19178027 GCATTAACACGCCTGTGTTAAGG - Intronic
903751697 1:25626055-25626077 TTATGTACAAGTCTGTGTGTGGG + Intronic
904826004 1:33274151-33274173 TTATTCACAAGCCTGTGGTCAGG + Intronic
905153875 1:35957034-35957056 TTCTTAACAACCATGTGTAATGG - Intronic
907774729 1:57502684-57502706 TATTTAACAAGTCTGTCTGATGG + Intronic
908671436 1:66552509-66552531 ATATAAACTTGCCTGTGTGAGGG - Intronic
910505077 1:87941282-87941304 TTATTAAGATGCCTGTTTTATGG + Intergenic
913164641 1:116173710-116173732 TTATGAACAGGGCAGTGTGAAGG - Intergenic
916491709 1:165307901-165307923 TTTTTAAAAAGACTGTGTGAAGG + Intronic
917362629 1:174193943-174193965 TTAACAACAATCCTGTGAGATGG + Intronic
918316928 1:183330199-183330221 TTTATAACAATCCTATGTGATGG - Intronic
918622437 1:186621013-186621035 CTATTCATAAGCCTGTGTGGTGG + Intergenic
920777739 1:208956614-208956636 ATATTGAAAAGCTTGTGTGATGG - Intergenic
921009551 1:211127504-211127526 TCATTTACAATCGTGTGTGAGGG + Intronic
923154548 1:231266692-231266714 TTATTAACAAGTATATGTGCAGG + Intronic
1065133968 10:22650199-22650221 GTATTTACAAGCAGGTGTGAAGG + Intronic
1065515339 10:26518896-26518918 TTAATAAAAAATCTGTGTGAAGG - Intronic
1065779167 10:29150877-29150899 TTCTTTGCAAGCCTGGGTGATGG + Intergenic
1075173521 10:120137989-120138011 TTATTCACAAACATGGGTGATGG + Intergenic
1076389267 10:130085683-130085705 TCATTAACAAGCTTAAGTGAAGG + Intergenic
1079101009 11:17542467-17542489 TTATTAATATCCCTGTGTGCAGG - Intronic
1081252639 11:40854219-40854241 TTATTGACAAGGCAGTGTTATGG + Intronic
1088636829 11:111829543-111829565 TTATAAACAAGCATATGTTAAGG + Intronic
1093706825 12:22283576-22283598 GTTTTAAAAATCCTGTGTGAAGG + Intronic
1094552281 12:31463962-31463984 TTATTAAAAAGCGTGTGGGCTGG - Intronic
1100286489 12:93171865-93171887 ATATTAAAATTCCTGTGTGATGG - Intergenic
1100668373 12:96781002-96781024 TCATTTGCAAGCCTGTGTGCTGG - Intronic
1104440800 12:128791864-128791886 TTATTATCAAGGCTGTGACAAGG + Intergenic
1104697790 12:130877415-130877437 TTTCTAACCAGCCTGTGAGATGG + Exonic
1104972062 12:132535296-132535318 TAATTAATGAGCCTGTGTCAGGG - Intronic
1105058419 12:133125804-133125826 TTCTTCACAAGCCTGTGAGGAGG - Intronic
1105348548 13:19596237-19596259 TTAATAAGAAGCCTCTGGGAGGG + Intergenic
1105658052 13:22461971-22461993 TTTTTAACAAGACAGTGTCAAGG + Intergenic
1105814911 13:24026434-24026456 TTATTTACTAGCCTTAGTGATGG + Intronic
1106282141 13:28284229-28284251 CTCTTAACAAGCATGTTTGAGGG + Intronic
1106487676 13:30186863-30186885 TTATTAACAAGCCAGAGCGGGGG + Intergenic
1107635010 13:42383284-42383306 TTTTTAACAAGACTGTTTCATGG + Intergenic
1109006854 13:56888201-56888223 TTATTAATATATCTGTGTGAAGG + Intergenic
1110621522 13:77601009-77601031 TTATTAACAAGCCTGTGTGATGG - Intronic
1113701182 13:112389873-112389895 TTCTTAACCAGCATTTGTGAAGG + Intronic
1114149371 14:20019411-20019433 TTATTCCCAAGCCTTTGTTATGG - Intergenic
1115504797 14:34083375-34083397 TTATTTGCTAGCCTATGTGAGGG - Intronic
1116231937 14:42229093-42229115 TTGTTACCTAGCCTGGGTGAGGG + Intergenic
1116544427 14:46146066-46146088 TTCTAAAGAAGGCTGTGTGAAGG + Intergenic
1117196559 14:53345550-53345572 TTATTAAAAAGTCTGTGTTGAGG + Intergenic
1119422399 14:74515222-74515244 ATATTAACCAGTCTGTGTGAAGG - Intronic
1119995125 14:79245123-79245145 TTATTAGGAACCCTGTGAGATGG - Intronic
1120315188 14:82883353-82883375 TTATTAACAAGTATGATTGAAGG - Intergenic
1126508458 15:49437325-49437347 GTTTTAACAAGCATGTCTGAAGG + Intronic
1126945949 15:53820297-53820319 CTATTAAGAAGCCTGGGGGAAGG - Intergenic
1128577899 15:68788909-68788931 CTCTTAACAACCCTGTGAGAGGG - Intronic
1129224455 15:74159872-74159894 TTCTCAACAATACTGTGTGAGGG - Intergenic
1129807282 15:78473607-78473629 CTTATAACAAGCCTGTGAGATGG + Intronic
1130146325 15:81276499-81276521 TCATTATCAAGGCTGTGTGCAGG - Intronic
1133130624 16:3674239-3674261 TGATTAACATGGCAGTGTGAGGG - Intronic
1133812209 16:9169549-9169571 TTCTTCACAAGACTGTGGGAGGG - Intergenic
1135465449 16:22681002-22681024 CTAATAACAACCCTGTGAGACGG - Intergenic
1138217904 16:55221559-55221581 TTTTTAACAATCTTGTGGGATGG - Intergenic
1140503634 16:75456033-75456055 AGATTAAGAAGCCTGTGTAAAGG - Intronic
1142302300 16:89265787-89265809 TTATTCACAAGTCTCTCTGAGGG + Intergenic
1142970962 17:3611226-3611248 TGGTTAAGAAGCCTGTGTTAGGG - Intronic
1144603925 17:16646802-16646824 GTCTTAACAAGCCTGTCTAAGGG - Intronic
1148166824 17:45489891-45489913 TTTTTAACAAGATTGGGTGAGGG + Intronic
1148367663 17:47068890-47068912 TTTTTAACAAGATTGGGTGAGGG - Intergenic
1148894695 17:50833008-50833030 TTATAAACAAGCCAGTGGGCGGG + Intergenic
1149226314 17:54475335-54475357 TTTTTTAAAAACCTGTGTGAAGG - Intergenic
1150398000 17:64836294-64836316 TTTTTAACAAGATTGGGTGAGGG + Intergenic
1151921286 17:77158002-77158024 ATATTAACAAGCATGTGGGCTGG + Intronic
1153193131 18:2564863-2564885 ATAATAACAAGCCTTTGTAAAGG - Intronic
1157642378 18:49230499-49230521 ATATTAACAAGTCTCTGTCATGG - Intronic
925522154 2:4758807-4758829 TTTATAACAACCCTGTGTGCTGG - Intergenic
925777676 2:7350553-7350575 TTATTGACAACCCTGTGTCTTGG + Intergenic
927785134 2:25968743-25968765 TTAGAAACCAGCCTGAGTGAAGG - Intronic
932000516 2:67880388-67880410 TTGTTATCAAGCCAGAGTGAGGG + Intergenic
932887312 2:75559886-75559908 CTCATAACAAGCCTGTGTGTAGG - Intronic
935311195 2:101785344-101785366 TTAATAGCAAGGCTCTGTGACGG + Intronic
935347539 2:102122510-102122532 TTACTAACAGGCGTGAGTGAGGG + Intronic
935885450 2:107614446-107614468 TTACTATCTAGACTGTGTGATGG + Intergenic
939508975 2:143083264-143083286 TCATTAAAAATCCTGTTTGAGGG + Intergenic
941151113 2:161916725-161916747 TTTTTAAAAAGACAGTGTGAAGG - Intronic
941351010 2:164436240-164436262 TGTTTAAGAAGACTGTGTGAGGG - Intergenic
941360565 2:164546587-164546609 TTTTTCACAAGCTTGTGGGAGGG - Intronic
945037060 2:205713207-205713229 TGATGAACAAGCCAGTGGGATGG + Intronic
948012221 2:234657963-234657985 TTTCTAACGAGCCTGTTTGAAGG + Intergenic
1168782586 20:506294-506316 TTTTTAACAGGCCTCTTTGAAGG + Intronic
1170570705 20:17630767-17630789 TCATTAACAAGCTTGTCTGGGGG + Intronic
1170702049 20:18712622-18712644 TTATTGAAAAGCCTGTGGGAGGG - Intronic
1171023366 20:21607274-21607296 TGATGAACAAGGCTGTGTGAGGG - Intergenic
1172562510 20:35902000-35902022 TTTTTAATAAGCCTGTTTCAAGG + Intronic
1177223925 21:18229336-18229358 TTATTCACAGGTCTGTGGGATGG + Intronic
1177248018 21:18555795-18555817 TTATAATCAAGACTGTGTTATGG + Intergenic
1178516933 21:33255888-33255910 TTGTTAACAAGCCTCTTTTAGGG - Intronic
1182026442 22:27122955-27122977 TTTTTAAAAAGTCAGTGTGATGG + Intergenic
951823481 3:26840767-26840789 TTGATAACAAGAATGTGTGATGG - Intergenic
955982435 3:64540448-64540470 TTCTAAACTAGCCTGTGTGTGGG - Intronic
956396987 3:68836425-68836447 CTATGAAGAAGCCTGTGTGTAGG + Intronic
960391003 3:117077692-117077714 TTTTTAACAAGGCTGAGTAACGG - Intronic
961234489 3:125353529-125353551 TTATTAAGATGTCTGGGTGAAGG + Intronic
961628212 3:128278299-128278321 GAATTAACAAGGCTTTGTGATGG + Intronic
961904407 3:130247706-130247728 CTATTCAAAAGCCTGTGTGTGGG - Intergenic
966234466 3:177685741-177685763 TTCTTAAGAAGAATGTGTGAAGG - Intergenic
967567885 3:190992710-190992732 TTCTTCCCAAGCCTGAGTGATGG - Intergenic
967994435 3:195155939-195155961 TGATTGTCAAGCCTGTGTCATGG - Intronic
969204274 4:5631023-5631045 TTCTTAGGAGGCCTGTGTGAGGG - Intronic
970453792 4:16200862-16200884 TTATTAACAAGCCTTTTTAAAGG - Intronic
970606628 4:17687625-17687647 TTTATAAGAAGGCTGTGTGAAGG + Intronic
970799834 4:19959639-19959661 TTATAATAAAGCATGTGTGATGG - Intergenic
972284643 4:37636641-37636663 TTTTCAAAAAGCATGTGTGAAGG + Intronic
972382361 4:38531247-38531269 TTAGAAACAAGCCAGTGGGAGGG + Intergenic
972997836 4:44904538-44904560 TTAATTAAAAGCTTGTGTGATGG + Intergenic
974966506 4:68767314-68767336 TTATTATAGAGCCTGGGTGATGG + Intergenic
975017588 4:69442223-69442245 TTAGTAACAACCCTTTGTAATGG + Intergenic
975033225 4:69650011-69650033 TTATAAACAAGCCAGTGGGGTGG - Intronic
977281465 4:95045085-95045107 TTATTAATGTGCCTGTGTGTTGG + Intronic
979126807 4:116982984-116983006 TTTTTAACAACCCTCTGTCATGG + Intergenic
981245437 4:142531682-142531704 TTTTTAACAAGCCTGCGTGAAGG + Intronic
986369236 5:7063358-7063380 TGATTAAAAAGCCTGTTTGGTGG - Intergenic
988381752 5:30505600-30505622 TTATGAAAAAGCGTGTGTCAGGG - Intergenic
989459027 5:41675307-41675329 TTAGTAACAAGCGTGGGTGTGGG - Intergenic
989976383 5:50592362-50592384 TTATAAACAAACATGTCTGAAGG - Intergenic
990134879 5:52633058-52633080 TAATCAACAAGCCTGTGAAATGG + Intergenic
990373882 5:55150390-55150412 TTTTTACTAAGCGTGTGTGAGGG + Intronic
995070651 5:107918011-107918033 TTAATAACAATCCTCAGTGAAGG + Intronic
1001644884 5:173272958-173272980 TTGGTCACCAGCCTGTGTGATGG + Intergenic
1004559722 6:16736947-16736969 TTATTTACCAGTCTCTGTGAAGG - Intronic
1005645274 6:27831860-27831882 TGATTAACTAGCCTGTGTGATGG - Intergenic
1007213621 6:40218524-40218546 TATTTAACAAGCCTGTGAGTTGG - Intergenic
1008430627 6:51412821-51412843 TTATGAAGAAGGCTGTGTGGTGG + Intergenic
1009465316 6:63961618-63961640 TTATAAAAAAGCCTGTTTGGTGG + Intronic
1010851769 6:80785429-80785451 TTATTCACAATCTTGTGAGAGGG + Intergenic
1018056249 6:160054841-160054863 TTATTAACAATCCCTTGTTAAGG + Intronic
1018129280 6:160713194-160713216 TTAATAACATCCCTGTGGGAAGG - Intronic
1019311597 7:364491-364513 TCCTTGACAAGCCTGTGTGTGGG + Intergenic
1021815425 7:24442597-24442619 TTTTTCACAAGTCTGTGGGATGG - Intergenic
1026510847 7:71026382-71026404 TTTTTAAAAAGAATGTGTGATGG + Intergenic
1032259124 7:130320607-130320629 ATATTAACAAGCCTGTTACATGG - Intronic
1033073238 7:138223883-138223905 TTATAAACAAGCCAGTGGGGTGG - Intergenic
1033813534 7:145045861-145045883 TAATTTAGAAGACTGTGTGATGG - Intergenic
1034687315 7:152984208-152984230 TTATAACCAAGCCTGTATGTAGG + Intergenic
1034967623 7:155401024-155401046 TTTTTAAAAAGCCTGTGTGCTGG + Intergenic
1037175581 8:15942981-15943003 TTTTTAACATGCATATGTGATGG + Intergenic
1041605640 8:59779739-59779761 TTATTAAAAAGCCTTAGAGAAGG - Intergenic
1042439378 8:68808174-68808196 TTTTTTAAAAACCTGTGTGAAGG - Intronic
1042610871 8:70599393-70599415 TAATTAACTAGCATGGGTGAGGG - Intronic
1042735098 8:71979024-71979046 TTTCTAACAAGCCAGTGTGAGGG - Intronic
1043793809 8:84509760-84509782 TTATTAAAAAGACTATGTTATGG + Intronic
1045917173 8:107485983-107486005 CTGTTAACAGGCCTGTGGGAGGG + Intronic
1051472989 9:17470699-17470721 ACATTAACAAGCCTGTATCAGGG - Intronic
1052955814 9:34252545-34252567 TTATTACCAAGGCTGTTTTATGG + Exonic
1053366159 9:37523978-37524000 TTACCCACAAGCCTGTGAGAAGG + Intronic
1057326360 9:94068079-94068101 TAATTAACAAGACTGTTTCATGG + Intronic
1057699403 9:97352184-97352206 TTATTAACATGCAAGTGTGTAGG + Intronic
1058065449 9:100543928-100543950 TTAATTACAGCCCTGTGTGAGGG + Intronic
1060144720 9:121242047-121242069 TTATTATCATGCCTGTCTGATGG - Intronic
1062042267 9:134409554-134409576 TTATTAACAAATCTGTGTCGGGG + Intronic
1188462209 X:30441557-30441579 TTAATGACAATCCAGTGTGATGG + Intergenic
1188482388 X:30649082-30649104 TTATTAACATGCATGTGAGTGGG + Intergenic
1188501346 X:30830319-30830341 ATGTTAACAAACCAGTGTGAGGG - Exonic
1188854548 X:35177173-35177195 TTATGGAGAAGCCTATGTGATGG + Intergenic
1189070028 X:37853699-37853721 TTATTTACAATGCTGTGTGCTGG + Intronic
1189640331 X:43062567-43062589 TTTTTAACAAGTCAGTGTCATGG + Intergenic
1193867439 X:86752432-86752454 TTAATAATAAGCCTATGTCAAGG - Intronic
1194484054 X:94465119-94465141 TTATTAACAATTCTTTTTGATGG - Intergenic
1195028821 X:100906556-100906578 TTTTTAACAGGCCTCTCTGAGGG - Intergenic
1197666844 X:129233437-129233459 TTATTAACAAGGCTGGATTAAGG + Intergenic