ID: 1110622457

View in Genome Browser
Species Human (GRCh38)
Location 13:77612509-77612531
Sequence GTTTTGGAAGAAGGGGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 406
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 371}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110622457 Original CRISPR GTTTTGGAAGAAGGGGAGCA AGG Intronic
901950326 1:12740231-12740253 GGTTTAGGAGAAGGGGAGAATGG + Intergenic
902491016 1:16780633-16780655 ATCGTGGAAGAAGGTGAGCATGG - Intronic
902579017 1:17396740-17396762 GTATTGGCATAAGGGGAGTAGGG + Intronic
902715151 1:18267588-18267610 AGCTTGGAAAAAGGGGAGCATGG + Intronic
904046376 1:27611641-27611663 GTGTGGAAACAAGGGGAGCAGGG - Intergenic
904046629 1:27613083-27613105 GTGTTGGAACAGGTGGAGCAGGG - Exonic
906141737 1:43537810-43537832 GTTCTGGCAGGAGGAGAGCATGG + Intronic
907704092 1:56818234-56818256 GTTTTGGAAAGGGGTGAGCAGGG - Intronic
907943326 1:59109719-59109741 ATTATAGAAGAAGGGGAGAAAGG + Intergenic
907984468 1:59516959-59516981 GTTCTGGAAAAAGAGGAGGAAGG + Intronic
910108330 1:83655367-83655389 ATTGTGGAAGAAGGGGAGGAGGG - Intergenic
910292192 1:85610183-85610205 GGGCTGGAGGAAGGGGAGCATGG - Intergenic
910633602 1:89382876-89382898 GGTAAGGAATAAGGGGAGCATGG + Exonic
910859309 1:91728240-91728262 GTGTTGGGATAAGGGAAGCATGG + Intronic
911170965 1:94770538-94770560 GTTTGGGGAGAAGGGGAGGAGGG + Intergenic
911197060 1:95005283-95005305 GTATTTGAAGATGGGGAGCCTGG + Intronic
912567649 1:110599783-110599805 GTGCTGGGAGAAGGGGAGCCTGG + Intronic
917361975 1:174186530-174186552 GTTGGTGTAGAAGGGGAGCAGGG - Intronic
917607838 1:176653093-176653115 GATTTGGGAAAAGGTGAGCATGG + Intronic
918462267 1:184788953-184788975 GTTCTGCAAGAAGCGGAGGAAGG - Intergenic
918988301 1:191662077-191662099 GTTTTGGTACAAGGGATGCAAGG - Intergenic
919032612 1:192262786-192262808 GTTTGGGAAGAATGGGAGTCAGG + Intergenic
919759973 1:201091737-201091759 GATGTGAAAGAGGGGGAGCATGG + Exonic
920303511 1:205004002-205004024 GTCCTGTAACAAGGGGAGCAAGG + Intronic
921307720 1:213813738-213813760 GCCTTGGAAGTGGGGGAGCAGGG + Intergenic
922430762 1:225550144-225550166 GGTTTGGAAGCATGAGAGCATGG - Intronic
922841856 1:228648516-228648538 GTCTTGCAAGAGGGGCAGCAAGG - Intergenic
923323438 1:232859047-232859069 GTTGTGGAGGAAGGGAGGCAGGG - Intergenic
923522111 1:234743212-234743234 TTTTTGGATGAAGAGTAGCAAGG + Intergenic
923529428 1:234801901-234801923 ATCGTGGAAGAAGGTGAGCATGG + Intergenic
924903954 1:248432493-248432515 GTTTTTGAATCAGGGTAGCATGG + Intergenic
924923917 1:248659508-248659530 GTTTTTGAATCAGGGTAGCATGG - Intergenic
1063505231 10:6591820-6591842 GCTGTGGGAGCAGGGGAGCAGGG + Intergenic
1063912495 10:10846171-10846193 GTCTTAGCAGAAGGGGAGGAAGG - Intergenic
1064614062 10:17134617-17134639 GTTTTGGAAGGAGGGAGGGAGGG - Intergenic
1064866130 10:19882552-19882574 TTTATGGAAGCAGGGCAGCAAGG - Intronic
1065874299 10:29983739-29983761 GTTTTGGAAGGAAGGAAGGAAGG + Intergenic
1067517873 10:46969291-46969313 GGTTTGGTAGAAGGGGAGAGTGG - Intronic
1067538340 10:47133703-47133725 GATTTGGTAGAACTGGAGCAAGG + Intergenic
1067644375 10:48082538-48082560 GGTTTGGTAGAAGGGGAGAGTGG + Intergenic
1067736411 10:48855090-48855112 GTTTTGGAATAAAGGGAATAGGG - Intronic
1067946836 10:50695037-50695059 GACTTGGAAAAAGGGGAGCAGGG - Intergenic
1070771863 10:79087264-79087286 GTGTTGGAGGAAGGGGAGCCTGG + Intronic
1070882144 10:79860030-79860052 GACTTGGAAAAAGGGGAGCAGGG - Intergenic
1071090038 10:81907810-81907832 ATTTTGGAAGAAGGGTATCAAGG - Intronic
1071128203 10:82360167-82360189 GTTGGGGAAGAAGGGGAGTGGGG + Intronic
1073022908 10:100461589-100461611 GTTTTGGAGCAAGAGGAACAAGG + Intergenic
1073821955 10:107274277-107274299 GTTTTGGCTGGAGGGGAGGAAGG + Intergenic
1075015077 10:118904460-118904482 GTTTTAGAAGATGGGAACCATGG - Intergenic
1075608294 10:123832037-123832059 TTTTTGGAGGAAGGGGCCCATGG - Intronic
1078963888 11:16314015-16314037 GTTTAGGATGAATGGGAGCAGGG - Intronic
1079877213 11:25874924-25874946 GTTTTGGAAGGAGAGCAGAATGG - Intergenic
1080061621 11:27962381-27962403 GTTCAGGAAGGAGGGGAGCCAGG - Intergenic
1080063366 11:27981200-27981222 GTCATGGAAGAAGGGTAGCATGG - Intergenic
1080432407 11:32210988-32211010 GTTTGGGAAGAAGGGGAGGGAGG + Intergenic
1081935851 11:46903554-46903576 GCTTTTGAAGAAGAGGAACAAGG + Intronic
1083842607 11:65313519-65313541 GGATGGGAAGAAGGGGATCATGG - Intergenic
1084087554 11:66861560-66861582 GGTTTAGATGAATGGGAGCAAGG + Intronic
1084551630 11:69846747-69846769 GTTTTGGAAAGAGATGAGCATGG + Intergenic
1085409083 11:76281093-76281115 GTCGTGGAAGAAGGGGAGGCAGG + Intergenic
1085778849 11:79390349-79390371 CTTTTGGAAGAAGAGCAGAAGGG - Intronic
1085988968 11:81816933-81816955 ATTGAGGAAGAAGGGGAGGAAGG - Intergenic
1086720832 11:90119042-90119064 GGGTTGGGAGAAGGGGAGGAAGG + Intergenic
1087018663 11:93579907-93579929 GGTTTGGAAGGAAGGGAGCCGGG + Intergenic
1088672434 11:112155743-112155765 GTATTGGAAGAGGGGCAGAAAGG - Intronic
1089459038 11:118642062-118642084 GTGAAGGAAGAAGGGGAGGAAGG - Intronic
1089768590 11:120786258-120786280 GTTTTAGAAGCAGAGGATCAAGG - Intronic
1091235077 11:134016274-134016296 GTTTAGGAAGTATGGCAGCAAGG + Intergenic
1092722481 12:11455535-11455557 GTCTTGGAAGAAGAAGAGTAGGG - Intronic
1093219344 12:16400220-16400242 GTTTGGGAAGAAGTGGCACATGG - Intronic
1094131350 12:27078969-27078991 GGTTTGGGAGAAGGGCAACATGG + Intergenic
1094173734 12:27521321-27521343 GTTTTGGAAAAATGTGAGCCTGG + Intergenic
1094857208 12:34411363-34411385 GTTTTGGTAGAATCGGAGAAGGG - Intergenic
1095289475 12:40461342-40461364 TGTTTGGAGGAAGGTGAGCAAGG - Intronic
1096240274 12:49956133-49956155 GTTGGGGAGGAAGGGGTGCAAGG - Exonic
1096250977 12:50032595-50032617 GTTTGGGAAGAAAGGGAGTTAGG - Intronic
1096603980 12:52751968-52751990 GGTTCTGAAGAAGGTGAGCAGGG - Intergenic
1096914759 12:55019776-55019798 GGGTTGGTGGAAGGGGAGCAGGG - Intergenic
1097923204 12:65099485-65099507 GGTTGGGGAGAAGGGGAGCCTGG - Intronic
1098834462 12:75405381-75405403 GTTTTGAAGGAAGGGTAACATGG + Intronic
1098921296 12:76304563-76304585 CTTCTGGAAGAAAGGGAGAATGG - Intergenic
1099738375 12:86600473-86600495 GTTGTGGAAGAATGTCAGCAGGG + Intronic
1099952797 12:89323266-89323288 GTTATGGAAGTGGGGAAGCAGGG - Intergenic
1100059639 12:90558610-90558632 GTGATGGAGGAAGGGGGGCAAGG - Intergenic
1102704451 12:114869147-114869169 GTTTTGCAGGGATGGGAGCAAGG - Intergenic
1102933953 12:116881609-116881631 GGTTTGGGAGACGGGGAGCGCGG + Intergenic
1103454074 12:121050990-121051012 GCTATGGAAGAAAGGGAGAAAGG + Intergenic
1105259726 13:18770094-18770116 GTGTTGGAAGATGGGGCGTAGGG - Intergenic
1105262406 13:18789417-18789439 GTGTTGGAAGATGGGGCGTAGGG - Intergenic
1106225914 13:27787068-27787090 GTCTTGGAAAAATGGGAGCAAGG - Intergenic
1106403961 13:29457307-29457329 GCTTTAGAAGAAGGGGGGCTTGG - Intronic
1107081057 13:36375198-36375220 GTTTTGGAAGGAGAGGATCAGGG + Intergenic
1108031637 13:46237213-46237235 GTTGTGGCAGAAGGGAAGAAAGG + Intronic
1108093612 13:46877743-46877765 GTTTTGGAAGAATCAAAGCAGGG + Intronic
1108583684 13:51849331-51849353 GGGCTGGAGGAAGGGGAGCACGG + Intergenic
1109023110 13:57123908-57123930 ATTTTGGAAGAAGGGCAGGCTGG + Intergenic
1109782057 13:67124750-67124772 GTTTTGGAGGAAGAGGAGACAGG + Intronic
1110112411 13:71764914-71764936 GCTTTGAAAAAAGGGAAGCATGG - Intronic
1110622457 13:77612509-77612531 GTTTTGGAAGAAGGGGAGCAAGG + Intronic
1111563229 13:89979869-89979891 TATTTGCCAGAAGGGGAGCAAGG - Intergenic
1112111077 13:96299758-96299780 GTTTTGAAGGAAGGGGAGAATGG + Intronic
1112795034 13:103047581-103047603 TTTTTGGAAAAAGGAGAGGAGGG - Intronic
1112904449 13:104400182-104400204 GTTTTGGAATCAAGGGATCATGG - Intergenic
1113799342 13:113078339-113078361 TGTTGGGAAGAAGGGGAGCGGGG - Intronic
1114299253 14:21359576-21359598 GTTTGGGAAGAAGCGGCACACGG - Exonic
1114538095 14:23435778-23435800 GTTTGGGAAGGGGGGGAGCCTGG - Intergenic
1116044103 14:39721768-39721790 ATTTTGGAAGAAAGTGAGAAAGG + Intergenic
1116299452 14:43159057-43159079 AATTTGGAAGAAGGGGAGAAAGG + Intergenic
1117126607 14:52634351-52634373 GTTTTGTAACAAGGAGGGCATGG - Intronic
1118284422 14:64458505-64458527 TTTTTGGAAGAAGCGCAGCATGG + Intronic
1119462511 14:74819745-74819767 GTTTTTTAAGAAGGTGGGCATGG - Intronic
1121863563 14:97341578-97341600 GGTAATGAAGAAGGGGAGCAGGG - Intergenic
1123716666 15:23038946-23038968 GTTTTGGAAAAAGGAGAGCAGGG + Intronic
1124880786 15:33640623-33640645 GATTAGGAAGAGGGAGAGCAGGG - Intronic
1125092476 15:35810465-35810487 ATTTTGGGACAAGGGGAGCTGGG + Intergenic
1126900048 15:53305530-53305552 GCTATGGAAGAAGGGAAGAATGG - Intergenic
1127482419 15:59389917-59389939 GTTCTGGAAGAGGGTGACCAGGG - Intronic
1127496399 15:59516486-59516508 GTTAAGGAAGAAAGGGAGAACGG + Intronic
1128785790 15:70395967-70395989 GCCTTGGAAGATGGGGAGGATGG + Intergenic
1129176757 15:73845857-73845879 ATTATGGAAGAAGGGGAGGATGG - Intergenic
1131097340 15:89664686-89664708 GTTTTCAATGAAGGGGAACAGGG + Exonic
1131520725 15:93112640-93112662 ATTATGGAAGCAGGGGAGAATGG - Intergenic
1133036918 16:3038677-3038699 CTTGTGGGAAAAGGGGAGCAAGG + Intergenic
1134130012 16:11642819-11642841 GCTTTGGAAGAAGGGGAGAGTGG - Intergenic
1134624309 16:15713066-15713088 GTTTTGTAGTAAGGGTAGCAAGG + Intronic
1135253050 16:20917171-20917193 GGTTTGGAGGAAGGTCAGCAGGG - Intronic
1135461122 16:22643849-22643871 GTTTTGGAACAAGGGAAGTAGGG + Intergenic
1135634175 16:24060008-24060030 GTTGTGGAAGAAAGGGGCCAGGG + Intronic
1135725209 16:24848950-24848972 GTTTTGGAAGTAAGAGAGAATGG + Intronic
1138541989 16:57694041-57694063 TTTTTGGAGGGAGGGGTGCATGG - Intergenic
1139263936 16:65622272-65622294 GATGTGGAAGAAAGGGAGGAGGG + Intergenic
1139287859 16:65831593-65831615 GTTTTGGAGGCAGTGGAGGAGGG - Intergenic
1140198676 16:72877040-72877062 GTTTTGGTAGATGGCGTGCAGGG - Intronic
1142980164 17:3666984-3667006 CTTTAGGTAGAAGGGGGGCAGGG - Intronic
1144793041 17:17872418-17872440 TTTTAGGAAGCAGGGGAGGATGG - Intronic
1144906170 17:18640521-18640543 GTTGTGGAAGAAGAAGGGCAGGG - Intronic
1145822387 17:27849087-27849109 GTGTTTAAGGAAGGGGAGCAAGG + Intronic
1148024908 17:44580254-44580276 GCTTTGGAAGAAAGAGAGGACGG - Intergenic
1148397655 17:47323491-47323513 GTTTTGGAAGAAAGGGGTCGGGG + Intronic
1149114559 17:53076867-53076889 AGTTTGGAAGAAGGTGAGCATGG - Intergenic
1150463657 17:65373322-65373344 GTTCTGGTAGAAGGGGAGGCGGG - Intergenic
1151081978 17:71340045-71340067 GTGTTGGAGGAAGGGAAGGATGG + Intergenic
1151971053 17:77457611-77457633 GTTCTGGAAGACTGGGAGGAGGG - Intronic
1152092979 17:78257184-78257206 GATTTGGGAGAAAGGGAGAAAGG - Intergenic
1153057022 18:955965-955987 GTGGTGGAAGAAGGGGAGGAAGG - Intergenic
1153330684 18:3870539-3870561 GTATTGGAACAATGGGACCATGG - Intronic
1153477479 18:5512717-5512739 GTTTTGGAAGGCAGGGAGGATGG + Intronic
1156010064 18:32487014-32487036 TTTTGGGAAGAAAGGAAGCAGGG - Intergenic
1156140287 18:34100371-34100393 GTTTGCTATGAAGGGGAGCAGGG - Intronic
1156205765 18:34883932-34883954 GTTTCTGAAGCATGGGAGCACGG - Intronic
1156367450 18:36442144-36442166 AATCTGGGAGAAGGGGAGCAGGG - Intronic
1157453117 18:47802647-47802669 GTTGGGGAGGAAGGGAAGCAAGG - Intergenic
1157606611 18:48929951-48929973 GTTATGGAACAAGGGGAGCCGGG - Intronic
1159101432 18:63963267-63963289 GTCTTGGAAGGAAGGAAGCAAGG - Intronic
1160143010 18:76342159-76342181 GATTTGGAGGAAGGGGGTCAGGG - Intergenic
1160492939 18:79353129-79353151 GTTTTGGCAGGCGGGCAGCAGGG + Intronic
1160879078 19:1311345-1311367 GGTTTGAAAGATGGGGAGCTGGG + Intergenic
1163811046 19:19431875-19431897 GCTGTGGAAGAAGAGGAGCAGGG + Intronic
1165771020 19:38380399-38380421 TTTTTGGAACAAAGTGAGCAGGG + Intronic
1166142315 19:40811675-40811697 GTTGTGGGAAGAGGGGAGCAGGG - Intronic
1166185207 19:41135122-41135144 GTTGTGGGAAGAGGGGAGCAGGG + Intergenic
1166219580 19:41355830-41355852 CTTTAGCAAGAAGGGGATCAAGG + Intronic
926244688 2:11113875-11113897 GTTGTGGAAGAAAGGAAGGAAGG - Intergenic
926305921 2:11637151-11637173 GGTATGGAGGAAGGGGAGGAGGG + Intronic
926326629 2:11790007-11790029 GTTTTGGAAATGGGGAAGCAGGG - Intronic
926411236 2:12604793-12604815 GTGTGGGAAGAGGGGGTGCAGGG + Intergenic
926452452 2:13022406-13022428 GTTTTGGGAGAGGGGAGGCACGG - Intergenic
926723735 2:15981872-15981894 GTTCTACAGGAAGGGGAGCATGG - Intergenic
927512201 2:23650858-23650880 GTTTTGTGAGAAGGTGAGCCAGG + Intronic
928001326 2:27525238-27525260 GTTTTGGAAGAAAGGAGGCTGGG + Intergenic
928459559 2:31457907-31457929 CTTCTGCAAGAAGGTGAGCATGG - Intergenic
928741664 2:34361531-34361553 GTGTTAGAAGAAAGGGAGCTTGG + Intergenic
929335443 2:40738533-40738555 GCTGAGGAAGAAGGGGAGGAGGG - Intergenic
930542431 2:52723600-52723622 GTTTTTGAAGAAGGAGAGTTCGG + Intergenic
931620431 2:64204574-64204596 CTTTAGGAAAAAGGGGAGGAGGG + Intergenic
932004861 2:67917877-67917899 ATGTTGGAAGAATGGGATCATGG - Intergenic
932035773 2:68245466-68245488 GTGTTAGAAGAAGGTGAGCTTGG - Intronic
932650396 2:73549650-73549672 GTTTTGGAGGAAGGAGAAAATGG - Intronic
932716775 2:74106344-74106366 GTTTTTGAGGAAGGGGAGTTGGG + Exonic
933560851 2:83884286-83884308 TTCTTGGAAGAAGTGGGGCAAGG - Intergenic
934083922 2:88493603-88493625 GTCATGGGAGAAGAGGAGCAGGG - Intergenic
935148176 2:100410344-100410366 GTAGTGGAGGAAGTGGAGCAAGG - Intronic
935174493 2:100637993-100638015 GTATTTCAAGAAGGAGAGCATGG + Intergenic
935251908 2:101270215-101270237 GTTTGAGAAGTAGGAGAGCAGGG + Exonic
937111359 2:119368991-119369013 GCTGAGGAAGAAGGCGAGCATGG + Intronic
937285968 2:120751334-120751356 GTTTGGGGGGAAGGGGAGAACGG - Intronic
937599044 2:123706649-123706671 GCTTTGGAAGTAGTGGAGGATGG - Intergenic
939177814 2:138769867-138769889 GTTTTGTAAGAATGGTAGCTAGG - Intronic
939184831 2:138847901-138847923 GTTTCGTAAGCAGGGGAGCCAGG - Intergenic
939443987 2:142285669-142285691 GTGTTAGAGGAAGGGGAGGAGGG - Intergenic
939689621 2:145241749-145241771 GTATTAGAAAAATGGGAGCAGGG - Intergenic
939884917 2:147671095-147671117 GTCCTGGAAGAAGTGGAGAATGG + Intergenic
942186296 2:173427877-173427899 GATTTGGATGTAGGGGAGCTGGG - Intergenic
942607963 2:177711877-177711899 GTCTGGGAAGAAGGGGAAAATGG + Exonic
942922058 2:181386632-181386654 GTTCTGGAAAAAAGGCAGCAGGG - Intergenic
943706309 2:191038551-191038573 GGTTTTGAAGGAGGGGTGCAAGG + Intronic
943924423 2:193754060-193754082 GTATTGGAGGCAGGGGAGAATGG - Intergenic
944429286 2:199615990-199616012 TTTTTGAATGAAGGGGAGCCTGG - Intergenic
944542968 2:200771173-200771195 GCTATGGAAGAAGGAGAGAATGG + Intergenic
944726415 2:202475630-202475652 TTTTTGAGAGAAGAGGAGCAAGG - Intronic
945128241 2:206537284-206537306 TTTTTGGCAGCAGGAGAGCATGG + Intronic
945765635 2:213973486-213973508 GTTCTGGAAGGAGCAGAGCAGGG - Intronic
946171690 2:217899490-217899512 GTTTTGGAGGATGGGGAGGAGGG - Intronic
946788398 2:223273315-223273337 AGCTTGGAAGAGGGGGAGCAGGG + Intergenic
946810375 2:223517765-223517787 GTTTTGAGAGAGGGGGATCATGG + Intergenic
946989908 2:225316868-225316890 GTTTGGGAAGAGGTGGAGGAGGG + Intergenic
948864625 2:240769027-240769049 CTCCTGGAAGTAGGGGAGCACGG - Intronic
1168851365 20:979235-979257 GTCTTGGCAGATGGGGAACATGG - Intronic
1168951782 20:1807145-1807167 ACTAAGGAAGAAGGGGAGCATGG + Intergenic
1169013970 20:2276109-2276131 GTTTTGCAAGGAGGGGTGCTAGG + Intergenic
1169123884 20:3113440-3113462 GGATTTGAAGAAGTGGAGCATGG + Intronic
1169756231 20:9046123-9046145 GTTTTGGAGGAAGGGGCGGGTGG + Intergenic
1170762426 20:19262648-19262670 GTTATGGAGAAAGGGGAGAAGGG - Intronic
1171088129 20:22257688-22257710 CTCTTGGAAGCAGGGGACCAGGG - Intergenic
1172445265 20:34990069-34990091 CTTCTGGAAGATGGGGACCACGG - Exonic
1172806641 20:37616602-37616624 GGTTTGGAAGGAGGCCAGCATGG + Intergenic
1173234094 20:41228007-41228029 GTTTGGGCAGAAGGAGAGGAAGG - Intronic
1173705291 20:45105777-45105799 GGTAAGGAAGAAGGGGAGAATGG + Intergenic
1175108964 20:56632386-56632408 GTTTTGCAGGATGGGGAGGAGGG + Intronic
1175138840 20:56844609-56844631 GTATAGGAAGCAGGGGATCAGGG - Intergenic
1175592464 20:60203946-60203968 GTGTTGGAAGAAGTAGAGCTTGG - Intergenic
1176045834 20:63092163-63092185 GTTTCTGGAGAAGGGGACCAGGG + Intergenic
1177078161 21:16604642-16604664 GGTTTGGAATAAGGAGAGAAAGG - Intergenic
1178929872 21:36808246-36808268 GTTTTTGAAGAACATGAGCATGG - Intronic
1179500034 21:41802875-41802897 GATTTGGCCGAAGGGAAGCACGG - Exonic
1181042951 22:20201465-20201487 GTTTAGGCAGAAAGGGAGGAAGG - Intergenic
1181722560 22:24786959-24786981 GTGTTGGAGTAACGGGAGCATGG + Intergenic
1182096968 22:27632551-27632573 GCATTGGAAGTAGGGAAGCATGG + Intergenic
1182180835 22:28346731-28346753 CATTTAGAGGAAGGGGAGCAAGG + Intronic
1182673482 22:32017831-32017853 GTTTAGGAAGGATGAGAGCAGGG - Intergenic
1182928507 22:34150672-34150694 GTTATAGAAGAAGGGGAGAATGG + Intergenic
1183456114 22:37924285-37924307 AAGTTGGAAGGAGGGGAGCAGGG + Intronic
1183583341 22:38738456-38738478 GATTTGGAAGAGGAGGAGCTAGG - Intronic
1183991376 22:41599223-41599245 GTTGTGGCAGAAGGGGCCCAAGG + Exonic
1184319787 22:43732111-43732133 GCTCTGGCAGAAGGGGAGCTGGG + Intronic
1185110276 22:48896666-48896688 GTTATGGGAGAATGGGAGCCAGG + Intergenic
949718204 3:6957959-6957981 ATTTTGGAAGCAGGTGATCAGGG + Intronic
950266231 3:11575163-11575185 GCATTGGCAGCAGGGGAGCAAGG - Intronic
950356020 3:12409962-12409984 AAGTTGGTAGAAGGGGAGCAGGG - Intronic
951742308 3:25938017-25938039 GTTTTGGAAAAAAGGGTACAAGG + Intergenic
952968223 3:38634102-38634124 CATTTGGGAGGAGGGGAGCAAGG - Intronic
953746625 3:45579346-45579368 GTTGTGGAGGATGTGGAGCAAGG - Intronic
953841724 3:46394988-46395010 GTATTGGAAGAAGGCAAGAATGG + Intergenic
954947678 3:54440631-54440653 GTTGTGGGCGGAGGGGAGCAGGG - Intronic
955621865 3:60873098-60873120 GTTTTTGGAGGAGGGGAACAAGG + Intronic
955717903 3:61850033-61850055 ATTTGAGAAGAAGGGGAGAAGGG - Intronic
955919355 3:63939224-63939246 GTTCTGTAAGATGGGAAGCATGG + Intronic
956029165 3:65018486-65018508 GTTTAGGAAGTAAGGAAGCAGGG + Intergenic
956320953 3:67995671-67995693 GTGTTAGAAGAAGGGGACAAAGG + Intergenic
956398739 3:68853504-68853526 GTCTGGGAAGAAGGAGAGGATGG + Intronic
957727764 3:84089318-84089340 ATTTTGGAATAAGTGCAGCATGG - Intergenic
958027831 3:88069832-88069854 GTTTTGAAAGCAGGAGAGTATGG + Intronic
958991219 3:100847994-100848016 GATTTGGAAGAAAAGGAGAAGGG - Intronic
959417480 3:106093876-106093898 GTTTTGTAAGAAAGACAGCATGG - Intergenic
959575533 3:107928942-107928964 GAGTTGGAAGAAGAGGAGAAAGG - Intergenic
959871540 3:111334159-111334181 GTTTTAGAAAAAGTGCAGCAGGG + Intronic
960203183 3:114862812-114862834 CTTTTGGAAGCAGAGGAGAAGGG + Intronic
962330767 3:134475957-134475979 GTTTGGGAAGCAGGGGAGGGTGG - Intergenic
962367778 3:134797191-134797213 GCTTTGTAGGGAGGGGAGCAAGG + Intronic
962731420 3:138286967-138286989 GTTTTGGAAGAAGGGCAGATAGG - Intronic
962956197 3:140269215-140269237 GTTTTGCAAGAAACTGAGCAAGG - Intronic
963282869 3:143403917-143403939 GTTTTGGAAGGAGAAGAGAAAGG - Intronic
964311750 3:155401342-155401364 GTTCTGGAACAAGGGAAACAAGG - Intronic
964494437 3:157272997-157273019 ATTATGGAAGAAGGGTAGAAAGG + Intronic
964514767 3:157495920-157495942 GTTCTGGAAGAAAGGGTTCAAGG - Intronic
965392904 3:168127494-168127516 TATTTGGAAGAAGGGGGTCAGGG + Intergenic
965516459 3:169626848-169626870 GTTTGGGAAAAAGAGAAGCAGGG - Intronic
965924126 3:173957494-173957516 GTTCTTCAAGAAGGGGAGAATGG - Intronic
967161881 3:186746324-186746346 GTATGAGCAGAAGGGGAGCATGG - Intergenic
968800679 4:2741626-2741648 GTGTTGGAAGCTGGGGTGCAGGG - Intronic
973590207 4:52433494-52433516 GAATTGGGAGAAGGGCAGCACGG + Intergenic
974510811 4:62838076-62838098 GACTTGCAAGAAGGGAAGCATGG - Intergenic
974563292 4:63551135-63551157 GTTGTGGAAAGAGGAGAGCAGGG + Intergenic
975382040 4:73711808-73711830 GTGTAGGAAGGAGGGGAACATGG + Intergenic
977443733 4:97101981-97102003 GGTGAGTAAGAAGGGGAGCAGGG - Intergenic
977784855 4:101020986-101021008 TTCTTGGAAGAAGGGGAGGTAGG - Intergenic
978751872 4:112258966-112258988 GTTTGGGGAGAGGTGGAGCATGG + Intronic
979586956 4:122431694-122431716 GTTTTTGACGAAGGGCAGCCCGG - Intergenic
982088051 4:151856160-151856182 ATTAAGGAAGAAAGGGAGCATGG + Intergenic
986184689 5:5424268-5424290 GTGTTGAAGGAAGGGGAGGAAGG + Intronic
986450370 5:7857545-7857567 GTTTTAGAAGGAAGAGAGCAGGG - Intronic
986720898 5:10561041-10561063 GGTTTGGAAGGAGGGAGGCAGGG - Intergenic
987601725 5:20080714-20080736 GATTAGGAAGAAGGGGAGAGAGG + Intronic
988243348 5:28643126-28643148 ATTTTCAAAGAAGGGGAGTAAGG + Intergenic
989053113 5:37340946-37340968 GTCAGGGAAGTAGGGGAGCAAGG - Intronic
990109393 5:52305115-52305137 GGTGTGTAAGAAGGGGAGCTCGG + Intergenic
991396681 5:66211312-66211334 GATTTGGAAGAAAGGAAGGATGG + Intergenic
992326273 5:75663314-75663336 GTTTTGGAACAAGGGGGCCTCGG - Intronic
992427083 5:76669373-76669395 GTTTTGGGAGCACGGGAGCCAGG + Intronic
992613788 5:78530973-78530995 GTTAATGAAGAAGGGGAGAATGG - Intronic
992823088 5:80518258-80518280 TTTTTGGAAAAAGAGGAGCTTGG + Intronic
993642315 5:90420167-90420189 GGATTGGAAGAAGGGGAGAATGG + Intergenic
994550651 5:101231099-101231121 GTGGTGGAAGGAGGGGAACAAGG + Intergenic
996727538 5:126685643-126685665 GTTTTGGAAGGTGGGGTGAAGGG + Intergenic
997569308 5:134913918-134913940 GCTGTGGAAGATGGGGTGCAAGG + Intronic
997572469 5:134941728-134941750 GTTTTGGAAAAAAGGGCACAGGG + Intronic
997713796 5:136027870-136027892 GGTAGGGAAGAAGGGGAGGAAGG - Intergenic
998769657 5:145527686-145527708 GTTTTGGAAGTAGTGGAGTCAGG - Intronic
999942071 5:156553615-156553637 GGGTTGTAAGAAGGGGAGGATGG - Intronic
1001044887 5:168364193-168364215 GTTCTGGAAGAGGTGGAGCCTGG + Intronic
1001247829 5:170118290-170118312 TATTTGGAAGGAGGGAAGCATGG - Intergenic
1001912557 5:175533096-175533118 GATTTGGAGGAAGGGGAGGTTGG + Intergenic
1002332907 5:178457058-178457080 TTTTTGGAACAAGGTGTGCATGG - Intronic
1002333542 5:178462089-178462111 ATTTTGGAAGGATGGGAGGAGGG + Intronic
1002925006 6:1600851-1600873 GTTTTGGCAGGAGCGGGGCAGGG - Intergenic
1003130572 6:3392071-3392093 CTGTAGGAAGAAGGGGAGCATGG - Intronic
1003732382 6:8839754-8839776 GTTTTGGAAAAGGAGGAGCTAGG - Intergenic
1004051226 6:12081596-12081618 GTTTTGGAGAAAGCAGAGCAGGG - Intronic
1005042894 6:21615319-21615341 TTTTTGGCAGGTGGGGAGCAGGG + Intergenic
1006031414 6:31179297-31179319 GTGTTTGGAGAAGGGGAGGATGG - Intronic
1006367283 6:33622906-33622928 GTTCTGCGAGAAGGCGAGCAGGG - Intronic
1006423319 6:33948919-33948941 GTGCAGGAAGACGGGGAGCAGGG + Intergenic
1006513271 6:34532946-34532968 GTGGTGGAGGAAGGGAAGCAGGG - Exonic
1006988523 6:38193394-38193416 GTTTTGGAAGCAGGAAAGAAGGG - Intronic
1007341273 6:41192804-41192826 GTTTTGGAAGAAGAGACACATGG - Exonic
1007991615 6:46262022-46262044 GTGTTGGGAGAAGAGGAGAAAGG - Intronic
1011408471 6:87040674-87040696 ATTTTGGAAGAAAGGGAGGGAGG + Intergenic
1012003256 6:93680976-93680998 GTTTTCCAAGAATGAGAGCAAGG + Intergenic
1012230398 6:96754293-96754315 GTTTTGGAAAGATGTGAGCAAGG - Intergenic
1013000253 6:106014861-106014883 GTTTGGGAAGATGGTGAGCAGGG + Intergenic
1013376304 6:109518220-109518242 CTTTTGGAGAAAGGGGAGCTTGG - Intronic
1014042030 6:116839060-116839082 GATTTGGAGTAAAGGGAGCAAGG + Intergenic
1014827781 6:126066108-126066130 ATTGTGAAAGTAGGGGAGCAAGG + Intergenic
1015012939 6:128374440-128374462 GTTTGGGAAGAATGGGAGTTAGG - Intronic
1015721750 6:136249966-136249988 GCTTCGGAGGAAGGTGAGCAAGG - Exonic
1015837282 6:137434002-137434024 TATTTGGAAGAAAGGGAGAAGGG - Intergenic
1015940908 6:138450989-138451011 CTATTGGAAGAGGAGGAGCAGGG - Intronic
1017200569 6:151749700-151749722 ATTCTGGAGGAAGGGGATCACGG + Intronic
1017418883 6:154251788-154251810 GACTGGGAAGAAGGGGAGGAAGG + Intronic
1017869468 6:158474555-158474577 CTTTTTGAAGAGAGGGAGCAGGG - Intronic
1018647303 6:165960573-165960595 GTCTTGAAAGGAGGAGAGCAGGG + Intronic
1019165254 6:170094229-170094251 GTTTGGGAACAAGGGGAGTTGGG - Intergenic
1020892312 7:13894052-13894074 GTTTTGGAAAATGGGTAGCTGGG + Exonic
1020934813 7:14449524-14449546 GTTTTTGAAGGAGAAGAGCAAGG - Intronic
1022196509 7:28072970-28072992 GCTTTGGGAGGAGGGGAACAAGG - Intronic
1022648822 7:32256450-32256472 GCTTTGGAGGAAGGGGAGCTGGG - Intronic
1023021957 7:36018946-36018968 GATTTGGAGGAATGGGGGCAGGG + Intergenic
1023046661 7:36215800-36215822 GATTTTCCAGAAGGGGAGCAGGG - Intronic
1023272204 7:38476138-38476160 TTTATGGAAGAAGGCGAGGAGGG + Intronic
1024051824 7:45628519-45628541 TTTCTGGAGGAAGGGGAACATGG + Intronic
1025599257 7:62974611-62974633 GTTTTGGGAGAATGTGAGAAGGG + Intergenic
1027236892 7:76303586-76303608 GTTTTGGGAGGAACGGAGCAGGG - Intronic
1028589804 7:92482675-92482697 GGTTGGGAAGAAGGGCGGCAAGG + Intergenic
1028930765 7:96410386-96410408 CTTTTGGAAGAAGGGTTGTATGG - Intergenic
1029465620 7:100722874-100722896 TTTCTGTAAGAAGGGGAGAAGGG + Intronic
1030173552 7:106628425-106628447 GAATTGGCATAAGGGGAGCATGG - Intergenic
1030553425 7:110993749-110993771 GTTTTGGCAGTAGGGGAGCAGGG - Intronic
1030560853 7:111084034-111084056 GTTGTGGAGGAAGGGAAGAATGG + Intronic
1031584214 7:123514748-123514770 GACTTGAAAGAAAGGGAGCATGG - Intronic
1031633540 7:124073656-124073678 TGTTTGGAAGTGGGGGAGCATGG + Intergenic
1031789290 7:126079918-126079940 GTTTTTGAAAAAGGGAAACAGGG - Intergenic
1032455394 7:132069482-132069504 TTTTTGGAAGGAGGAGAGGAAGG + Intergenic
1034246838 7:149651347-149651369 GGTGAGGAAGAAGGGGAGCTTGG - Intergenic
1034646145 7:152649704-152649726 CTTTAGGAAGAAGGGAAGAATGG - Intronic
1036962465 8:13260008-13260030 AATTTGGATGAAGGGGATCATGG + Intronic
1037693889 8:21207256-21207278 GTTGAGGAAGAAGAGGAGAAAGG - Intergenic
1037878382 8:22560665-22560687 GTTTAGGGAGACGGGGAGTAGGG + Intronic
1038349394 8:26762560-26762582 GTTTAGCAAGAAGGGGAGAGTGG + Intronic
1038515790 8:28186737-28186759 GTTTTACAAGAAGAGGAACAGGG - Intronic
1038840203 8:31177716-31177738 CTTTGTGAAGAATGGGAGCACGG + Intergenic
1039430696 8:37522900-37522922 TTTTTAGAAGAAGAGGAGCTGGG + Intergenic
1039661535 8:39472212-39472234 CTTTTGGAAGAAGAGAGGCAGGG - Intergenic
1041119770 8:54574401-54574423 CTGTTAGAGGAAGGGGAGCATGG + Intergenic
1041600580 8:59712608-59712630 TTGTTGGAATCAGGGGAGCATGG - Intergenic
1041713657 8:60914611-60914633 GTTTAGGAAAAAGAGAAGCAGGG - Intergenic
1041967378 8:63695071-63695093 GATTTTCAAGAAGGGTAGCAAGG + Intergenic
1042022947 8:64389730-64389752 GTTTTGAAAGCAGTGAAGCATGG + Intergenic
1042464564 8:69112924-69112946 GTTTTGGAGAAATGGGAGGATGG - Intergenic
1043637676 8:82406766-82406788 GTTTTTGAAAAAGGGGACTAAGG - Intergenic
1043792385 8:84488527-84488549 TATTGGGAAGAAAGGGAGCAAGG - Intronic
1045500947 8:102743957-102743979 GTTACGGATGAAGGGGAGAAAGG - Intergenic
1045502049 8:102751160-102751182 ATTATGGAAGAAGGGAAGAAGGG - Intergenic
1047480560 8:125278141-125278163 GTTGTGGAAGGAAGGAAGCATGG + Intronic
1047680191 8:127246837-127246859 TTTTGCTAAGAAGGGGAGCAGGG + Intergenic
1047681698 8:127260187-127260209 ATTTTGGGAGAAGGGAAGGAGGG - Intergenic
1047885848 8:129249255-129249277 TTCATGGAGGAAGGGGAGCAGGG - Intergenic
1048442791 8:134472267-134472289 GTTCTGGGCTAAGGGGAGCAGGG - Intergenic
1049613967 8:143568319-143568341 GGGTGGGAAGAGGGGGAGCAAGG + Intronic
1049921094 9:365038-365060 GTTTTGAAAAAAGGCCAGCATGG + Intronic
1051349173 9:16183008-16183030 GTTCTGCAAGAAGGGGAACGTGG - Intergenic
1051429664 9:16969002-16969024 GTTATGGAAGTAGGAGAGAATGG - Intergenic
1052104847 9:24500597-24500619 GCTTTCTAAGAAGGGGTGCATGG - Intergenic
1052557558 9:30036716-30036738 GTTTTGGAAGAAGGTAAATAAGG - Intergenic
1052779689 9:32768273-32768295 GTTTTGGCATAAGGGGAACAAGG - Intergenic
1055402807 9:75942356-75942378 GTGTTGGGAGAAAGGGAGAAAGG + Intronic
1058952207 9:109914438-109914460 GCTTTGAGAGAAGGGGAGGATGG + Intronic
1059249351 9:112874584-112874606 GTTTTGGCATAATGGCAGCATGG - Exonic
1060001984 9:119967156-119967178 GTTATGAAACAAGGGGAGCATGG - Intergenic
1060005607 9:119996950-119996972 GGTTTGTGAGAAGGGGAGCAAGG + Intergenic
1186153962 X:6706757-6706779 GGTCGGGAAGAAGGGAAGCAAGG - Intergenic
1186494247 X:9999197-9999219 GTCCTGCAAGAAGGGGAGAATGG + Intergenic
1186788701 X:12976038-12976060 GTTTTGAAATATGGGGAGGAGGG + Exonic
1188167101 X:26875054-26875076 GTTTGGAAAGAAGGCAAGCAAGG - Intergenic
1189832261 X:44986842-44986864 GTTTTGGAAGAAGTGGGGTGTGG + Intronic
1192780159 X:74285972-74285994 GTGTAGGAAGGAGGGGGGCAAGG + Intergenic
1194536272 X:95108620-95108642 GGTTAGTAAGAAGGGGAGCTCGG - Intergenic
1194771299 X:97909079-97909101 GATTTGGAAGGGGGAGAGCAAGG + Intergenic
1195501941 X:105612429-105612451 GTTGTGGAAGGGGTGGAGCAAGG + Intronic
1197572192 X:128163325-128163347 GTTTTTGGAGGAGGGGGGCATGG - Intergenic
1197746635 X:129935895-129935917 ACTGTGGAAGAAGGGAAGCAGGG + Intergenic
1197749572 X:129955267-129955289 GATTTGGAAGAAGGGCACCAGGG + Intergenic
1199287590 X:146071187-146071209 GTTTTGGAAGAAGTTGATGATGG - Intergenic
1199443837 X:147898320-147898342 CTTTTGGAAGAAGAGGATGATGG - Intergenic
1199598026 X:149523433-149523455 GGTCTGGAAGCAGGGGACCAAGG + Intronic
1199746369 X:150774375-150774397 GTTTTAGAGGAGAGGGAGCAAGG - Intronic
1200738884 Y:6831601-6831623 GTTATGAAAGAAGGGAGGCAGGG - Intergenic