ID: 1110626777

View in Genome Browser
Species Human (GRCh38)
Location 13:77662072-77662094
Sequence GGCTGCTTCCCCATTGCTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110626775_1110626777 -4 Left 1110626775 13:77662053-77662075 CCAGGGGCCTAGAGGTGGAGGCT 0: 7
1: 3
2: 10
3: 72
4: 972
Right 1110626777 13:77662072-77662094 GGCTGCTTCCCCATTGCTACAGG No data
1110626771_1110626777 5 Left 1110626771 13:77662044-77662066 CCTGAGTCTCCAGGGGCCTAGAG 0: 10
1: 1
2: 3
3: 22
4: 203
Right 1110626777 13:77662072-77662094 GGCTGCTTCCCCATTGCTACAGG No data
1110626770_1110626777 6 Left 1110626770 13:77662043-77662065 CCCTGAGTCTCCAGGGGCCTAGA 0: 10
1: 1
2: 7
3: 21
4: 179
Right 1110626777 13:77662072-77662094 GGCTGCTTCCCCATTGCTACAGG No data
1110626766_1110626777 25 Left 1110626766 13:77662024-77662046 CCAGGAGGAAGTGAGGTTTCCCT No data
Right 1110626777 13:77662072-77662094 GGCTGCTTCCCCATTGCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110626777 Original CRISPR GGCTGCTTCCCCATTGCTAC AGG Intergenic
No off target data available for this crispr