ID: 1110627593

View in Genome Browser
Species Human (GRCh38)
Location 13:77668704-77668726
Sequence CTACCACAGCTGATGTTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110627590_1110627593 -7 Left 1110627590 13:77668688-77668710 CCGGCTCCTCTCCATACTACCAC No data
Right 1110627593 13:77668704-77668726 CTACCACAGCTGATGTTCTCTGG No data
1110627588_1110627593 0 Left 1110627588 13:77668681-77668703 CCCATGGCCGGCTCCTCTCCATA No data
Right 1110627593 13:77668704-77668726 CTACCACAGCTGATGTTCTCTGG No data
1110627585_1110627593 5 Left 1110627585 13:77668676-77668698 CCCCACCCATGGCCGGCTCCTCT No data
Right 1110627593 13:77668704-77668726 CTACCACAGCTGATGTTCTCTGG No data
1110627589_1110627593 -1 Left 1110627589 13:77668682-77668704 CCATGGCCGGCTCCTCTCCATAC No data
Right 1110627593 13:77668704-77668726 CTACCACAGCTGATGTTCTCTGG No data
1110627586_1110627593 4 Left 1110627586 13:77668677-77668699 CCCACCCATGGCCGGCTCCTCTC No data
Right 1110627593 13:77668704-77668726 CTACCACAGCTGATGTTCTCTGG No data
1110627587_1110627593 3 Left 1110627587 13:77668678-77668700 CCACCCATGGCCGGCTCCTCTCC No data
Right 1110627593 13:77668704-77668726 CTACCACAGCTGATGTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110627593 Original CRISPR CTACCACAGCTGATGTTCTC TGG Intergenic
No off target data available for this crispr