ID: 1110628227

View in Genome Browser
Species Human (GRCh38)
Location 13:77675958-77675980
Sequence CAGAAGCAGCAGAAGCAGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110628225_1110628227 -1 Left 1110628225 13:77675936-77675958 CCATGACTGCCTTTCTCAGTATC No data
Right 1110628227 13:77675958-77675980 CAGAAGCAGCAGAAGCAGTAAGG No data
1110628224_1110628227 0 Left 1110628224 13:77675935-77675957 CCCATGACTGCCTTTCTCAGTAT No data
Right 1110628227 13:77675958-77675980 CAGAAGCAGCAGAAGCAGTAAGG No data
1110628226_1110628227 -10 Left 1110628226 13:77675945-77675967 CCTTTCTCAGTATCAGAAGCAGC No data
Right 1110628227 13:77675958-77675980 CAGAAGCAGCAGAAGCAGTAAGG No data
1110628223_1110628227 1 Left 1110628223 13:77675934-77675956 CCCCATGACTGCCTTTCTCAGTA No data
Right 1110628227 13:77675958-77675980 CAGAAGCAGCAGAAGCAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110628227 Original CRISPR CAGAAGCAGCAGAAGCAGTA AGG Intergenic
No off target data available for this crispr