ID: 1110630109

View in Genome Browser
Species Human (GRCh38)
Location 13:77697883-77697905
Sequence CCCGGCGGCCGCGGCGCCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 497
Summary {0: 1, 1: 0, 2: 3, 3: 55, 4: 438}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110630096_1110630109 15 Left 1110630096 13:77697845-77697867 CCCCGTGGCCCGAGGAGCCGGCG 0: 1
1: 0
2: 0
3: 22
4: 127
Right 1110630109 13:77697883-77697905 CCCGGCGGCCGCGGCGCCCTCGG 0: 1
1: 0
2: 3
3: 55
4: 438
1110630098_1110630109 13 Left 1110630098 13:77697847-77697869 CCGTGGCCCGAGGAGCCGGCGCG 0: 1
1: 0
2: 0
3: 13
4: 153
Right 1110630109 13:77697883-77697905 CCCGGCGGCCGCGGCGCCCTCGG 0: 1
1: 0
2: 3
3: 55
4: 438
1110630097_1110630109 14 Left 1110630097 13:77697846-77697868 CCCGTGGCCCGAGGAGCCGGCGC 0: 1
1: 0
2: 0
3: 11
4: 174
Right 1110630109 13:77697883-77697905 CCCGGCGGCCGCGGCGCCCTCGG 0: 1
1: 0
2: 3
3: 55
4: 438
1110630102_1110630109 6 Left 1110630102 13:77697854-77697876 CCGAGGAGCCGGCGCGGCGGCGC 0: 1
1: 0
2: 4
3: 26
4: 231
Right 1110630109 13:77697883-77697905 CCCGGCGGCCGCGGCGCCCTCGG 0: 1
1: 0
2: 3
3: 55
4: 438
1110630101_1110630109 7 Left 1110630101 13:77697853-77697875 CCCGAGGAGCCGGCGCGGCGGCG 0: 1
1: 0
2: 0
3: 56
4: 242
Right 1110630109 13:77697883-77697905 CCCGGCGGCCGCGGCGCCCTCGG 0: 1
1: 0
2: 3
3: 55
4: 438
1110630094_1110630109 18 Left 1110630094 13:77697842-77697864 CCTCCCCGTGGCCCGAGGAGCCG 0: 1
1: 0
2: 0
3: 18
4: 131
Right 1110630109 13:77697883-77697905 CCCGGCGGCCGCGGCGCCCTCGG 0: 1
1: 0
2: 3
3: 55
4: 438
1110630103_1110630109 -2 Left 1110630103 13:77697862-77697884 CCGGCGCGGCGGCGCGCACTCCC 0: 1
1: 0
2: 1
3: 19
4: 142
Right 1110630109 13:77697883-77697905 CCCGGCGGCCGCGGCGCCCTCGG 0: 1
1: 0
2: 3
3: 55
4: 438
1110630092_1110630109 24 Left 1110630092 13:77697836-77697858 CCGTAGCCTCCCCGTGGCCCGAG 0: 1
1: 0
2: 1
3: 7
4: 118
Right 1110630109 13:77697883-77697905 CCCGGCGGCCGCGGCGCCCTCGG 0: 1
1: 0
2: 3
3: 55
4: 438

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110630109 Original CRISPR CCCGGCGGCCGCGGCGCCCT CGG Intronic