ID: 1110630380

View in Genome Browser
Species Human (GRCh38)
Location 13:77698898-77698920
Sequence CAGTGTTTTCGGAGGGATGA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 171}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110630373_1110630380 18 Left 1110630373 13:77698857-77698879 CCATGTCATCTTGTCTTTTTGCT 0: 1
1: 0
2: 5
3: 32
4: 535
Right 1110630380 13:77698898-77698920 CAGTGTTTTCGGAGGGATGACGG 0: 1
1: 0
2: 0
3: 10
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110630380 Original CRISPR CAGTGTTTTCGGAGGGATGA CGG Exonic
902217892 1:14945937-14945959 CAGTGTTGACGGAGGGCTCATGG + Intronic
902275299 1:15335173-15335195 CAGTGTGTTCGGAAGGGTGGAGG + Intronic
902286896 1:15412909-15412931 CAGGGTTCTAGGAGGGCTGATGG + Intronic
902634825 1:17728447-17728469 CAGCATTTTGGGAGGGATGCAGG - Intergenic
905132901 1:35774829-35774851 CAGTGTTTCCCCAGGGACGAAGG - Intergenic
905380003 1:37555155-37555177 CTGTGCTTTGGGAGAGATGATGG - Intergenic
906095030 1:43217104-43217126 GAGTGTGTGCAGAGGGATGAGGG + Intronic
906339926 1:44970628-44970650 CAGTGTTTGCTAAGGGATGTCGG - Intronic
911785813 1:101945480-101945502 CAGTGGTTTCTGTGGGAGGAGGG + Intronic
912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG + Intronic
913390171 1:118301950-118301972 TGGTGGTTTCTGAGGGATGAAGG - Intergenic
915067602 1:153239491-153239513 CAGGGTTTGCAGAGGCATGAGGG - Intergenic
915966398 1:160312494-160312516 AAGGGTTTTCTAAGGGATGATGG - Intronic
916522509 1:165577560-165577582 AAGGGATTTCTGAGGGATGATGG + Intergenic
924464321 1:244286258-244286280 CAGTGTTTTCAGAGGGTGGCAGG - Intergenic
1063163878 10:3442324-3442346 CAGTGGTTTCCGGGGGCTGAAGG - Intergenic
1064341649 10:14491003-14491025 CAGTGACTTGGGAGGGAGGAGGG + Intergenic
1065671293 10:28121059-28121081 CAGTGTTTTGGGAGGCAAGGTGG + Intronic
1067934051 10:50593062-50593084 CTCTGTTTTCGGAGGGAAGCTGG + Intronic
1070241125 10:74682125-74682147 CAGTGTTTTGAAAGGGATTAGGG + Intronic
1074010396 10:109472942-109472964 CAGTGTTTTCTGAAGGTCGAGGG + Intergenic
1076539797 10:131206749-131206771 CAGTGATTTCCCAGGGATGTGGG + Intronic
1079299114 11:19261523-19261545 CAGTGGTTTCTGAGGGGTGGGGG - Intergenic
1087282804 11:96231225-96231247 AAGTGTTTTCGGAGTTGTGAGGG - Intronic
1087886117 11:103484700-103484722 AAGTGTTTTGGGAGGGAGGCAGG - Intergenic
1088848624 11:113687978-113688000 CTGTGGTTGCTGAGGGATGAGGG - Exonic
1089453475 11:118612390-118612412 CAGCATTTTCTGAGGGAGGAGGG - Intronic
1090158871 11:124470516-124470538 CAGTGTTGTCAGTGGGATGTAGG + Intergenic
1090450059 11:126798239-126798261 CAGTGTGTTCTGAGAGAGGAAGG - Intronic
1094640960 12:32275334-32275356 CAGTGGTTTGGGAGTGAGGATGG + Intronic
1095474865 12:42576003-42576025 CAGTGTTTTGTAAGGGAGGAAGG - Intronic
1096270950 12:50166402-50166424 GAGTGTGTTCGAAGGGATGGAGG - Intronic
1097971478 12:65637939-65637961 AAGTGTTTGTGGAAGGATGAAGG + Intergenic
1098251799 12:68577833-68577855 AAGTGGTTTTGGAGGGAGGAGGG - Intergenic
1098450495 12:70613150-70613172 CAGTGGTGTTGGATGGATGAGGG + Intronic
1098813526 12:75126978-75127000 CACTGTTTTAGTAGGCATGATGG - Intronic
1099054268 12:77818552-77818574 CAGTGTCTTTGCAGGGATGAGGG + Intergenic
1100900209 12:99231204-99231226 CTGTGTTTTGGGAGGGCTGTGGG + Intronic
1101438659 12:104686053-104686075 AAATGTTTTCGTAGAGATGAGGG - Intronic
1102708180 12:114901111-114901133 CTGTCTTTTCTGAGGAATGAGGG - Intergenic
1103167523 12:118783107-118783129 CCGTGTTGTCTGAGGGATGAGGG + Intergenic
1104312147 12:127663217-127663239 CAGTGCCCTCAGAGGGATGATGG - Intergenic
1107496970 13:40936105-40936127 CAGTGTTTTCGTATGTAAGATGG - Intronic
1107636852 13:42400814-42400836 CAGTGTTCTAGGAGTAATGATGG + Intergenic
1107814357 13:44231215-44231237 GAATTTTTTAGGAGGGATGAAGG - Intergenic
1108487051 13:50937395-50937417 CATTTTTTTTGGAGAGATGAGGG + Intronic
1108637305 13:52348357-52348379 CTGTGTTTCTGCAGGGATGAAGG - Intergenic
1108716859 13:53088730-53088752 CAGTGTTTAGGCAGAGATGAAGG - Intergenic
1110473382 13:75885803-75885825 CATTGTTTTCGTAGAGATGACGG - Intergenic
1110630380 13:77698898-77698920 CAGTGTTTTCGGAGGGATGACGG + Exonic
1111819596 13:93196280-93196302 CTGTGTTTTGAGATGGATGAAGG - Intergenic
1113747266 13:112754062-112754084 CAGTGTTTTGGGATTGAGGAGGG + Intronic
1113781503 13:112980132-112980154 GTGTGTTTTGGGTGGGATGAGGG + Intronic
1114491763 14:23106796-23106818 CTGTGCTTTGGGAGAGATGAGGG - Intergenic
1116836675 14:49775497-49775519 CATTGTATTTGGTGGGATGAGGG + Intronic
1118536388 14:66771063-66771085 CAGTGGCTTAGGAAGGATGAAGG - Intronic
1118858858 14:69646087-69646109 CAGTTTTATCGGAGTGGTGAAGG - Intronic
1119542448 14:75449532-75449554 CAGTCTTTTGGGGGTGATGAGGG + Intronic
1122001554 14:98660587-98660609 CAGTGGTTGCCTAGGGATGAGGG + Intergenic
1122438204 14:101713002-101713024 CAGTGGGTTGGGAGAGATGACGG - Intergenic
1122584434 14:102795326-102795348 CAGTGTTTTGGGATTAATGAGGG + Intronic
1123033343 14:105461456-105461478 AAGTATTTTAGGAGGGCTGACGG - Intronic
1125712833 15:41800680-41800702 CAGTGGTTGCCTAGGGATGAAGG - Intronic
1125925389 15:43558883-43558905 CAGTGTTTCCAGAGGGTAGATGG + Exonic
1126038761 15:44570778-44570800 CAGGGACTTCGGAGGGCTGATGG - Intronic
1126952533 15:53897450-53897472 CCTTGTTTTTGTAGGGATGAGGG + Intergenic
1127561021 15:60136099-60136121 CAGTGGTTTCTCAGTGATGATGG - Intergenic
1130243570 15:82221308-82221330 CAGTGCTTACGGAGAGAGGAGGG - Intronic
1130456898 15:84119973-84119995 CAGTGCTTACGGAGAGAGGAGGG + Intergenic
1132193536 15:99891205-99891227 CAGTGGATTTGTAGGGATGAAGG - Intergenic
1134040050 16:11061437-11061459 CAGTGTTTAGGTAAGGATGAAGG + Intronic
1135399952 16:22159843-22159865 CAGTGTCTTCAGAGGGAGCATGG - Intergenic
1135705465 16:24671041-24671063 CAGTGCTGTCGGAGGGTTGCTGG - Intergenic
1137087782 16:36149825-36149847 TAGGTTTTTCGAAGGGATGAAGG - Intergenic
1137638790 16:50010361-50010383 CACTGTGTTTGGAGGGAGGATGG + Intergenic
1140981659 16:80115902-80115924 CAGTTTTTTCGGAGGGGTGGGGG - Intergenic
1141684608 16:85563105-85563127 CCGTGTATTCGAAGGGAAGAGGG + Intergenic
1141851656 16:86650246-86650268 GAGTGTGTTCTGGGGGATGAAGG + Intergenic
1142043795 16:87912515-87912537 GGGTGTTTTCGGATGAATGAGGG - Intronic
1143741058 17:8954400-8954422 CTGTGTTTTCAGAGGGAGTAAGG - Intronic
1144415558 17:15042876-15042898 CAGATTTTTCAGAGGGAGGAAGG + Intergenic
1144481416 17:15632611-15632633 TAGTGTTTACGTAGGGCTGAAGG - Exonic
1144707952 17:17382102-17382124 CAGTTTCTTTGGAGCGATGATGG - Intergenic
1146707456 17:35011707-35011729 CAGTGATCTTGGAGTGATGATGG - Exonic
1146793312 17:35765011-35765033 CAGGTTTGTCAGAGGGATGAGGG - Exonic
1147692760 17:42327206-42327228 CAGTTATTTCTGAGGGAGGAGGG - Intronic
1151345212 17:73497263-73497285 CAGTGTCTTGGGAGGAAAGAGGG - Intronic
1151366742 17:73622528-73622550 CAGTGTTTGAGGAGGGAGGGAGG + Intronic
1156179345 18:34584794-34584816 AAGTGTTTTCAGAGAGAAGAAGG + Intronic
1157011129 18:43650232-43650254 CTGTGTTTTGGGAGAGAGGAAGG + Intergenic
1160659375 19:291165-291187 CAGGGTCCTCGGAGGGACGAGGG + Exonic
925033127 2:666700-666722 CAGAGTTCTCGGAGGCAGGAAGG - Intergenic
926176769 2:10600199-10600221 TAGTGTTTTCAGATGTATGAAGG - Intronic
926197600 2:10773139-10773161 CTGTGTGTCAGGAGGGATGAAGG + Intronic
926309075 2:11661567-11661589 CAGTGTTGTAGGAGGGAAAATGG + Intronic
926436564 2:12844446-12844468 CAGTGTTCTAGCAGGGGTGATGG - Intergenic
927892418 2:26760128-26760150 AAGTGTTTTTGTAGAGATGAGGG + Intergenic
928208721 2:29307170-29307192 CAGTATTTTCTGTGGGTTGAAGG - Intronic
929452325 2:42046407-42046429 CAGTGTTCTCGGAGGAATCATGG + Intergenic
930238956 2:48916046-48916068 CAGCGTCTTCGCAGGGATGCAGG + Intergenic
935271130 2:101435317-101435339 GTGTGTTTCGGGAGGGATGAGGG + Intronic
935602121 2:104933449-104933471 CAGTGCTTTCGGAGAAATGAGGG + Intergenic
937712559 2:124995145-124995167 CTGTGCTTTTGGAGAGATGATGG - Intergenic
938650108 2:133374325-133374347 CAGTGTTTTCCAGGGGATAAGGG + Intronic
940265675 2:151833271-151833293 CTGTGTTTTTGTAGGGATGGTGG - Exonic
943048732 2:182890296-182890318 CTGGGTTTTCTGAGGGATGCAGG - Intergenic
945736015 2:213601297-213601319 CAGTGTTTTGGAAGAGATGGAGG + Intronic
947500414 2:230667211-230667233 CAGTGCTTTTGGAGGGAGCATGG - Intergenic
947530798 2:230907563-230907585 CAGTGTTTTGGGATGGGTCAGGG + Exonic
1168984818 20:2039057-2039079 GAGTGGTTTAGGAGGGATGGAGG - Intergenic
1174286271 20:49475936-49475958 CAGGGTTGTCTGAAGGATGAAGG - Intronic
1182069928 22:27456327-27456349 TAGTGATTTTGGAAGGATGAAGG + Intergenic
1182096877 22:27631257-27631279 GTGTGTTTTCGGAGGGCTGTGGG + Intergenic
1185327917 22:50236578-50236600 GATTGTTTTCGCAGGGAGGACGG - Intronic
949564886 3:5235373-5235395 GAGTGTATTTGGAGGGATTAAGG + Intergenic
951120438 3:18920698-18920720 CTGTGTTTTCAGAAGGAGGAAGG - Intergenic
952743871 3:36760201-36760223 CACTGTGTTTGGAGAGATGATGG - Intergenic
952868008 3:37870174-37870196 ACGTTTTTTCGGAGGGATGGGGG + Intronic
953391350 3:42535699-42535721 CAGTGAGTGGGGAGGGATGAGGG + Intronic
953756261 3:45648259-45648281 CAGTGGTTGCTTAGGGATGAGGG - Intronic
955473229 3:59308830-59308852 GAGAGTTTTCAGAAGGATGATGG + Intergenic
955856697 3:63279547-63279569 CAGTGTTGTTGGCTGGATGATGG + Intronic
960421969 3:117457627-117457649 CAGTGTGTAAGGAGGAATGAAGG + Intergenic
960768371 3:121164121-121164143 TAGTGATTTCCTAGGGATGAAGG - Intronic
962199223 3:133388018-133388040 CAGTGTTTTGTGGGGCATGATGG + Intronic
963364627 3:144319527-144319549 CAGTGATCTCTGAGGGATCAGGG + Intergenic
971155296 4:24075262-24075284 CTGTGTTTTCACAGGGAGGAAGG - Intergenic
974483398 4:62475067-62475089 CAGTGCTTTCAGAGGGAACATGG - Intergenic
974901857 4:68009060-68009082 CAGTGTTGTCGGATGGGTGGGGG - Intergenic
982113397 4:152076541-152076563 CATTGTTTTCTGATGGGTGAGGG - Intergenic
987869619 5:23598413-23598435 CAGTGCTTTCGGAGGAAGGCTGG + Intergenic
989596115 5:43157749-43157771 TAGTGTCTTGGGAGGGATCATGG - Intronic
991720452 5:69490880-69490902 TAGTGGTTGCCGAGGGATGAGGG + Intergenic
997124226 5:131209760-131209782 CAGTGGTTTCCAAGAGATGAGGG + Intergenic
997773305 5:136574490-136574512 TAGTCTTTTCAGAGGGTTGATGG - Intergenic
998434443 5:142095610-142095632 CTGTGTTTTGGAAGGGAGGAGGG + Intergenic
998644498 5:144047453-144047475 CAGGGTTTTGGGAGGTGTGAGGG + Intergenic
999269631 5:150289328-150289350 CAGTGTGTATGTAGGGATGAAGG - Intronic
1004567129 6:16808430-16808452 CAGTGTCCTTGCAGGGATGAGGG - Intergenic
1006608126 6:35274117-35274139 CATTAGTTTGGGAGGGATGAAGG - Intronic
1006815078 6:36844705-36844727 TAGTGCTTTGGGAGGGGTGAGGG - Intergenic
1007696387 6:43736724-43736746 GAGTGTTTTGGGAGGGATGTGGG + Intergenic
1009700552 6:67172469-67172491 CAGGGTTTTGGGAGTGGTGATGG + Intergenic
1015996093 6:138996684-138996706 CAGTGGTTGCGGGGGGCTGAGGG - Intergenic
1016751420 6:147634447-147634469 CAGTGTTGGAGGAGGGAGGAGGG - Intronic
1017054720 6:150426481-150426503 CAGTGTTCTCAGAGGAAGGAGGG + Intergenic
1018221414 6:161583976-161583998 GAGTGTTTTGGCAGGAATGATGG - Intronic
1018255935 6:161919331-161919353 CAGTGTTTGCCTAGGGCTGAAGG + Intronic
1021707530 7:23382336-23382358 CAGTGTTTTCTGAAAGATGCAGG - Intronic
1034375478 7:150640331-150640353 GAGTGTTTTTGTATGGATGATGG - Intergenic
1034676410 7:152895553-152895575 CACTGTTTTGGAAGGCATGAAGG + Intergenic
1036096466 8:5729674-5729696 CAGTTTTCTCTGAGGAATGATGG - Intergenic
1039653224 8:39367102-39367124 TAGTGTTTTCTGAGGCACGAAGG - Intergenic
1041761767 8:61375053-61375075 AAGAGTTTATGGAGGGATGAAGG - Intronic
1042490121 8:69387788-69387810 CAGTGTCTTAGGTGGAATGAGGG - Intergenic
1043951924 8:86318935-86318957 AAGTGATTCCGGAGGGATTAAGG + Intronic
1044431028 8:92106878-92106900 CAGTTTATTTGGGGGGATGATGG - Intergenic
1045886033 8:107098793-107098815 CTGTGTTTTGGGAGAGATGGAGG + Intergenic
1046850133 8:118962778-118962800 TAGTGTTTGCTGAGGGCTGAGGG - Intergenic
1051759980 9:20452146-20452168 CAGAGTTTTCACAGGAATGAGGG - Intronic
1052515574 9:29475086-29475108 CAGCGTTTTTGCAGGGGTGAGGG + Intergenic
1053434408 9:38065976-38065998 CAGGGTTACAGGAGGGATGAAGG - Intronic
1055296752 9:74841095-74841117 AAGTGTTTTCAGAGGGATAATGG - Intronic
1056548483 9:87632790-87632812 CAGTGTATATGTAGGGATGAAGG + Intronic
1056548497 9:87632936-87632958 CAGTATATACGTAGGGATGAAGG + Intronic
1056842897 9:90013146-90013168 CAATGTTTTCAGAGGAATAATGG + Intergenic
1057157492 9:92856091-92856113 CTGTGTTTTCTGAGGTATGTGGG - Intronic
1057691136 9:97287324-97287346 CACTTTTTTGGGAGGGATGTTGG - Intergenic
1058071719 9:100608221-100608243 CAGTTTTTTCTAAGGGAAGATGG + Intergenic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059185899 9:112270684-112270706 CAATGTTTTTTGAGGGTTGAAGG - Intronic
1061248741 9:129414434-129414456 CAGAGTTTTCTGCGGGATGAGGG - Intergenic
1062730437 9:138105422-138105444 CTGTGCTTTCAGAGGGATCAAGG + Intronic
1190099997 X:47515359-47515381 CCATGTTTTGGCAGGGATGAGGG - Intergenic
1194087165 X:89542551-89542573 CAGGGTTTTAGGGGGGAGGAGGG + Intergenic
1194751749 X:97693150-97693172 CAGTTCTTTAGGAAGGATGAAGG + Intergenic
1194840464 X:98734336-98734358 CAGTGTTTTGTAAGGTATGAAGG + Intergenic
1195661737 X:107385464-107385486 CAGTGTTATCGATGGGAGGAGGG - Intergenic
1196533928 X:116818334-116818356 AAGTGTTTTCAGAGGGATAATGG + Intergenic
1198961472 X:142188013-142188035 TAGTGGTTTCCGAGGGCTGAGGG - Intergenic
1199604831 X:149568932-149568954 AAGTGTTTTCTGAGAGATAAGGG - Intergenic
1200439813 Y:3198424-3198446 CAGGGTTTTAGGGGGGAGGAGGG + Intergenic