ID: 1110631893

View in Genome Browser
Species Human (GRCh38)
Location 13:77718171-77718193
Sequence GAGTGAACAAACTGTCTCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 135}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110631888_1110631893 16 Left 1110631888 13:77718132-77718154 CCATTGAGATCTATATTTTAGAG 0: 1
1: 0
2: 0
3: 20
4: 269
Right 1110631893 13:77718171-77718193 GAGTGAACAAACTGTCTCAAGGG 0: 1
1: 0
2: 2
3: 15
4: 135
1110631890_1110631893 -8 Left 1110631890 13:77718156-77718178 CCTTACCTGTAACTGGAGTGAAC 0: 1
1: 0
2: 0
3: 9
4: 84
Right 1110631893 13:77718171-77718193 GAGTGAACAAACTGTCTCAAGGG 0: 1
1: 0
2: 2
3: 15
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110631893 Original CRISPR GAGTGAACAAACTGTCTCAA GGG Intronic
900330672 1:2133035-2133057 GGGTGAACAAACTCTCCCACAGG - Intronic
909209047 1:72799162-72799184 GAGTGAACATACTGTAATAATGG + Intergenic
910835761 1:91508170-91508192 GATTGTAAAAACTGTTTCAATGG - Intronic
917303037 1:173598720-173598742 GAGTGAATAAATTAACTCAAGGG + Intronic
921086937 1:211802870-211802892 GAGCCAACAAACTGTCAGAAAGG + Intronic
924404563 1:243729529-243729551 GAGTGAAATTACTGGCTCAAAGG - Intronic
924821473 1:247495150-247495172 GACTTAAGAAACTGACTCAAAGG + Intergenic
1069051992 10:63804637-63804659 GAGTGAACAAAATATCTGACAGG - Intergenic
1079919692 11:26417494-26417516 GAGTGAACAAACAGGATAAAGGG + Intronic
1081918484 11:46750040-46750062 AAGTGAAGAAGCTGTCTCAAGGG + Intronic
1085997455 11:81937396-81937418 GAGTGAAGAAAGTTTTTCAAAGG + Intergenic
1086551951 11:88063043-88063065 AATCGAATAAACTGTCTCAAGGG + Intergenic
1088493038 11:110405223-110405245 AAGTGGACAAACTGTCTGAATGG - Intergenic
1089137178 11:116258916-116258938 GAGTGAATAAATTGCCTAAAGGG + Intergenic
1089965708 11:122653571-122653593 GAGTCAAAAAACTATCTTAAAGG + Intergenic
1095391308 12:41709909-41709931 GCCTGAACAAACTCTCTAAAGGG - Intergenic
1095767732 12:45915423-45915445 GAGTGCTCAAAATGTTTCAATGG - Intergenic
1096164253 12:49407952-49407974 GAGTCCACAAACTCTGTCAAGGG - Intronic
1097375839 12:58841372-58841394 CAGTGAACAGTCTGTCTCACTGG + Intergenic
1097554012 12:61115263-61115285 GAATGAAGAAAATGTCTCTAAGG + Intergenic
1098780140 12:74676524-74676546 GAGTGAACCGTCTGTCTCACTGG - Intergenic
1104768125 12:131343757-131343779 AAGTGGACAAGCTGTCTGAATGG + Intergenic
1110631893 13:77718171-77718193 GAGTGAACAAACTGTCTCAAGGG + Intronic
1115162357 14:30410416-30410438 GAGTGAACGATCTGTCTCACTGG + Intergenic
1116993960 14:51303392-51303414 AAGAGAACAAACTGGCTAAATGG - Intergenic
1117629325 14:57673388-57673410 GGGTGAAGTAACTTTCTCAAAGG - Intronic
1117634939 14:57732196-57732218 GAGTGAACAAAATGGTTAAATGG + Intronic
1119883570 14:78121654-78121676 GGATGAACAGACTGTCTCCAGGG + Intergenic
1120929031 14:89828822-89828844 TAGTGAAAAGACTGTATCAAAGG + Intronic
1124917017 15:33985862-33985884 CAGTGAAAAAACTATCTCTAAGG + Intronic
1125421803 15:39511599-39511621 GAGTGAACGAACTTCCTGAAGGG - Intergenic
1128555001 15:68625552-68625574 GAGTGCACAAGCAGGCTCAAAGG - Intronic
1131981019 15:97994827-97994849 GATTAAACAATATGTCTCAATGG - Intergenic
1132637301 16:957803-957825 GAGTGAACAAATTCTGACAAAGG + Intronic
1138145602 16:54607599-54607621 GAGTCAAAAAAAAGTCTCAAGGG + Intergenic
1138407192 16:56805735-56805757 AAGTGAAGAAAGTGTTTCAAGGG - Intronic
1144128272 17:12222255-12222277 GAGTGAACCAAGTTTCTAAATGG + Intergenic
1146545582 17:33735246-33735268 CAGGGAACAAACTTTCTCCATGG - Intronic
1146659498 17:34654947-34654969 GAGTTAACAAACTTTCTCAAAGG + Intergenic
1151968863 17:77446842-77446864 AAGAAAACAAACTGGCTCAAGGG + Intronic
1153085171 18:1278114-1278136 GATTGAAAAAACAGTCTCAGAGG + Intergenic
1155361513 18:25007631-25007653 GAGTGTACAAAATGTCTCCATGG - Intergenic
1159159504 18:64624954-64624976 GAGTTTTCAAACTGTTTCAAAGG + Intergenic
1164458859 19:28430792-28430814 GAGTGCACACACTGCCTAAATGG - Intergenic
1164911763 19:32018450-32018472 TACTGAACACACAGTCTCAAAGG + Intergenic
1165697102 19:37908818-37908840 GAGTGAACATACTGGCTCTGTGG - Intronic
1167993267 19:53378784-53378806 CCGTGACCAAATTGTCTCAAAGG + Intronic
1168001844 19:53452811-53452833 CCGTGACCAAATTGTCTCAAAGG + Intronic
925759976 2:7175300-7175322 GAGTTAACAAATTGAATCAAAGG + Intergenic
929430488 2:41882179-41882201 GAGTGAAAAGACTGGCTCAAGGG + Intergenic
930769311 2:55115884-55115906 GAGTCATCAAAATGTTTCAAGGG - Intergenic
930954062 2:57182695-57182717 GAGTGAACAGACTTTTTAAAAGG + Intergenic
933043895 2:77508928-77508950 GAATGAAAAAACTGTTTCTAAGG + Intronic
933344105 2:81061425-81061447 GAGTGAACAAGCACTTTCAAGGG - Intergenic
933811906 2:86037896-86037918 GAGTGTGGAACCTGTCTCAAGGG - Intronic
933856969 2:86424075-86424097 TAGAGAAATAACTGTCTCAATGG + Intergenic
934027919 2:88016674-88016696 GAGCGGACAAAATGTCTCAAAGG - Intergenic
934190888 2:89792461-89792483 GAGTCATCAAATGGTCTCAAAGG - Intergenic
935805882 2:106747299-106747321 GAGTGGCCAAACTGTCGGAAAGG - Intergenic
936811394 2:116407417-116407439 CAGTGAAGAAAATGTCTCCAGGG + Intergenic
939588832 2:144038492-144038514 TAGTGAATAAACTGTTTAAAAGG - Intronic
940079242 2:149781345-149781367 GAGAGAATAAACTCTCTTAAAGG - Intergenic
941650040 2:168082693-168082715 GAGTGAACACACCTTCTCCATGG + Intronic
942216311 2:173722648-173722670 GAGTGAACTAGCTGGGTCAATGG - Intergenic
942729465 2:179048240-179048262 GACTGTCCAAACTGTCTCAGGGG - Intronic
943779833 2:191811139-191811161 GAGTGAACTAATTGTTTAAACGG + Intergenic
948678907 2:239618487-239618509 GACTGTAGAAACAGTCTCAAAGG - Intergenic
1169045812 20:2533692-2533714 GAGTGACAACACTGTCTCACCGG + Intergenic
1173899409 20:46576163-46576185 GAGTCAACAAACTTTCTGCAGGG + Intronic
1176103010 20:63373017-63373039 GAGTTAACCAACAGTCTCCATGG - Intronic
1177432221 21:21004981-21005003 GAGTGAACAAATTGTAAGAAGGG + Intronic
1182080795 22:27527181-27527203 GAGAGAACAAACTGTCTCTAAGG - Intergenic
1182948512 22:34348659-34348681 TAGTGAACTAACTTACTCAAGGG - Intergenic
1183833921 22:40436312-40436334 AAGTGGCCAAACTGTTTCAATGG + Intronic
1183926154 22:41207686-41207708 GAGGGAAGACACTGTCTCAAAGG - Intronic
951577728 3:24130692-24130714 GAGTGCACATACTTTCTCGAGGG + Intronic
952326561 3:32325562-32325584 GAGTGAACTTACTCTCTCAGGGG + Intronic
952558773 3:34564948-34564970 GATTGAGAAAACTGTCTCAAAGG + Intergenic
953741964 3:45545910-45545932 GAGTGAATAACCTGTGTAAAGGG - Intronic
959704391 3:109326121-109326143 GAGTAAATAAACTGTCTTACTGG + Exonic
962610882 3:137075276-137075298 GAGTGCACAAACTCAATCAATGG + Intergenic
964649125 3:158991563-158991585 GAGTGAACAGTCTGTCTCGCTGG + Intronic
965875026 3:173306164-173306186 GTGTGAGGAAACTGTCTCAGAGG + Intergenic
966744403 3:183262414-183262436 CAGTGAACAAAATGTCAAAACGG - Intronic
967879353 3:194288277-194288299 GAGTGAACAATCTATCACTAAGG + Intergenic
971382063 4:26108100-26108122 TAGAGGACAAACTGTCTCCATGG - Intergenic
972067013 4:34960266-34960288 GAGTGAACATATTTTCTCTACGG + Intergenic
972088698 4:35253552-35253574 GAGTAAATAAAATGTCACAATGG - Intergenic
974934508 4:68396798-68396820 GAATGAACAAAGTATCTCATTGG + Intergenic
975698773 4:77041800-77041822 GAGAGATCCAACTTTCTCAATGG + Intergenic
976074163 4:81277853-81277875 GAGTGTACAAACTGTTTCCTGGG - Intergenic
978293198 4:107171026-107171048 TAGAGAACAAAGTGTCTCAATGG + Intronic
978443679 4:108760612-108760634 GATAGAACAAAATTTCTCAAAGG - Intronic
978600525 4:110422679-110422701 TTCTGAACAAACTGTCACAAGGG + Intronic
978652389 4:111021690-111021712 GAGGGAATAAACTTTCTCATGGG - Intergenic
981909699 4:149964784-149964806 AAGTGAAGTAACTTTCTCAAGGG + Intergenic
986666243 5:10107521-10107543 GAGTGAAGAAGCTGTCCAAATGG + Intergenic
986898349 5:12399382-12399404 GAGAAAATAATCTGTCTCAATGG + Intergenic
993636390 5:90349317-90349339 GACTGAATAAACTGGCTAAAGGG + Intergenic
995816676 5:116177175-116177197 CAGTGGACAAAGTGTCTTAATGG + Intronic
996829566 5:127725227-127725249 GAGTAAACAACCTGTCTCTATGG - Intergenic
998372538 5:141670983-141671005 GAGAGATCACACTGTCTCCAGGG + Intronic
999151567 5:149429761-149429783 GAGTGAAGACCCTGACTCAAAGG - Intergenic
999953226 5:156672370-156672392 TAGTGAAGAAACAGTCTCTAGGG + Intronic
1002353476 5:178603012-178603034 TATTAAACAAACTGTCACAATGG + Exonic
1003843920 6:10152707-10152729 GGATGAACAAACTCTCTAAAGGG + Intronic
1004135414 6:12961438-12961460 AAGTGAAGAAACTGACTCAATGG - Intronic
1004384398 6:15159887-15159909 TAGGGAACAACCTGTCTCAGTGG + Intergenic
1006857310 6:37143975-37143997 GAGTGTACAAAATATCTGAAAGG - Intergenic
1008096041 6:47340506-47340528 GAGTGTGCAACCTCTCTCAAAGG - Intergenic
1009778153 6:68233032-68233054 TGGGGAACAAGCTGTCTCAAGGG - Intergenic
1013050656 6:106531633-106531655 AAATGAACAAACTGTCGTAAAGG - Intronic
1014168552 6:118252823-118252845 AAGTGAAGAAAGTGTTTCAAGGG + Intronic
1015388267 6:132651116-132651138 GAGGGAAGAAATTGTTTCAAGGG - Intergenic
1016402414 6:143694749-143694771 GAATTACCAACCTGTCTCAATGG - Intronic
1017971828 6:159318464-159318486 GTGTAAACATACTGTCTCCAAGG - Intergenic
1020785073 7:12563416-12563438 GAGTAAGCAAACTGACTGAAAGG - Intergenic
1021242211 7:18217431-18217453 AAGTGAACAAACTATATCTAAGG - Intronic
1021968248 7:25943341-25943363 GAATGCAGAAAATGTCTCAATGG + Intergenic
1021997241 7:26192096-26192118 AAGCTAAGAAACTGTCTCAAAGG + Exonic
1023052266 7:36263313-36263335 CAGAGAACACCCTGTCTCAAGGG + Intronic
1024584826 7:50833071-50833093 AAGTGAACTCACTGTCTAAAAGG + Intergenic
1027686768 7:81288240-81288262 GATTGGACAAACTTTTTCAAAGG + Intergenic
1028291823 7:89075222-89075244 CAGTGAAGAAAATGTCTCTAGGG + Intronic
1029132458 7:98342738-98342760 GGATGAAAAAACTGACTCAAAGG + Intronic
1031489850 7:122373154-122373176 GTGTGAACAAACTGTCTTATAGG + Intronic
1032650581 7:133873797-133873819 GTGTGAAGAGATTGTCTCAAAGG + Intronic
1033353674 7:140582612-140582634 GAGGGAACAACCTATCCCAAAGG - Intronic
1033997863 7:147374662-147374684 GAGGAAGCATACTGTCTCAATGG - Intronic
1035366793 7:158353770-158353792 AAGTGTAGAAACTGTGTCAAGGG - Intronic
1037662156 8:20937216-20937238 GAGCGAACATACTATTTCAATGG - Intergenic
1042097573 8:65234473-65234495 GAGTGAACAGTTTTTCTCAAAGG + Intergenic
1045248099 8:100460640-100460662 GAATGAACAAATAGGCTCAAAGG - Intergenic
1046452930 8:114417148-114417170 GATTGGACTTACTGTCTCAAGGG + Intergenic
1047817976 8:128485588-128485610 AAGTGATCAAACTGTCTTAAAGG + Intergenic
1048440755 8:134457565-134457587 GCTGGAACAAACTGTGTCAAGGG - Intergenic
1050585929 9:7111618-7111640 GTGTGCACAAACTTCCTCAAAGG + Intergenic
1052450587 9:28625156-28625178 GAGGGAATAACCTATCTCAATGG - Intronic
1056385596 9:86094322-86094344 GAGTTGACAAACTGTCTAAATGG - Intronic
1062675566 9:137741346-137741368 GAGTCAGCAAACTGTTTCCAGGG + Intronic
1187276151 X:17818025-17818047 GAGTGACCAAACTGACACCATGG + Intronic
1187409083 X:19032637-19032659 GAGTGAGAAAACTTTCTAAAGGG + Intronic
1187623542 X:21085733-21085755 GAGTGAACCCACTGTCTTAAAGG + Intergenic
1190458734 X:50649856-50649878 GAGTGGAAAAACTGGATCAAAGG - Intronic
1191986107 X:66982772-66982794 CAGTGAAAAAAATGTCTCCAGGG - Intergenic
1192448263 X:71226272-71226294 AAGAGGAAAAACTGTCTCAAGGG - Intergenic
1192970978 X:76229655-76229677 GAGGGCACAAACTGTTTCATTGG - Intergenic
1193178796 X:78428965-78428987 GAGTGAACAAACTTGCAGAATGG - Intergenic
1193949306 X:87778550-87778572 TAGTGAACAGACTGTCTCGCTGG - Intergenic
1194391404 X:93322033-93322055 AAGAGAACAAACTGCCTTAAAGG - Intergenic
1198304701 X:135368823-135368845 CAGTGAAGAAAATGTCTCCAGGG - Intergenic
1199810512 X:151344181-151344203 GAGTGAAGAAGCTGTCACCATGG - Intergenic
1201406909 Y:13658862-13658884 AAGTGGACAAGCTGTCTGAATGG + Intergenic