ID: 1110632914

View in Genome Browser
Species Human (GRCh38)
Location 13:77730314-77730336
Sequence GTTCACCAGATTTCCAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 216}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110632914_1110632920 22 Left 1110632914 13:77730314-77730336 CCTTTTTTGGAAATCTGGTGAAC 0: 1
1: 0
2: 1
3: 14
4: 216
Right 1110632920 13:77730359-77730381 TTAGAAATTCTTTGGAACATGGG 0: 1
1: 0
2: 2
3: 33
4: 320
1110632914_1110632917 -3 Left 1110632914 13:77730314-77730336 CCTTTTTTGGAAATCTGGTGAAC 0: 1
1: 0
2: 1
3: 14
4: 216
Right 1110632917 13:77730334-77730356 AACTGTGGAGAGTGAAATGGTGG 0: 1
1: 1
2: 2
3: 42
4: 409
1110632914_1110632921 27 Left 1110632914 13:77730314-77730336 CCTTTTTTGGAAATCTGGTGAAC 0: 1
1: 0
2: 1
3: 14
4: 216
Right 1110632921 13:77730364-77730386 AATTCTTTGGAACATGGGTAAGG 0: 1
1: 0
2: 2
3: 16
4: 185
1110632914_1110632919 21 Left 1110632914 13:77730314-77730336 CCTTTTTTGGAAATCTGGTGAAC 0: 1
1: 0
2: 1
3: 14
4: 216
Right 1110632919 13:77730358-77730380 TTTAGAAATTCTTTGGAACATGG 0: 1
1: 0
2: 3
3: 41
4: 417
1110632914_1110632918 14 Left 1110632914 13:77730314-77730336 CCTTTTTTGGAAATCTGGTGAAC 0: 1
1: 0
2: 1
3: 14
4: 216
Right 1110632918 13:77730351-77730373 TGGTGGTTTTAGAAATTCTTTGG 0: 1
1: 0
2: 2
3: 17
4: 293
1110632914_1110632916 -6 Left 1110632914 13:77730314-77730336 CCTTTTTTGGAAATCTGGTGAAC 0: 1
1: 0
2: 1
3: 14
4: 216
Right 1110632916 13:77730331-77730353 GTGAACTGTGGAGAGTGAAATGG 0: 1
1: 0
2: 0
3: 17
4: 329

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110632914 Original CRISPR GTTCACCAGATTTCCAAAAA AGG (reversed) Intronic
901472091 1:9464523-9464545 GTACAACAGATTTTCAACAAAGG - Intergenic
906948016 1:50312110-50312132 TTTCCCCAGATTTTTAAAAAAGG + Intergenic
907224315 1:52930110-52930132 GGTCACCAGAATTTCAAAAAAGG - Intronic
907640642 1:56186062-56186084 TTTTACCAGCTTTCCAGAAAAGG - Intergenic
912574577 1:110655504-110655526 TTTCATCAGATTTAAAAAAATGG + Intergenic
912858860 1:113195361-113195383 GAGCACCAGCTTTCAAAAAAGGG - Intergenic
913274405 1:117122792-117122814 ATTCTCCAAAATTCCAAAAATGG + Intergenic
917745624 1:178004058-178004080 GTTCACCAAAGTTCAAGAAAAGG + Intergenic
917872498 1:179254613-179254635 GTTCCCCAGATCTCTAATAATGG + Intergenic
918026688 1:180756940-180756962 GTTCAACTGATTTTCAACAAAGG - Intronic
919835995 1:201573757-201573779 TTTCATCAGATTCCCAAAAAGGG - Intergenic
922410693 1:225372313-225372335 CTTCACCAGATATCAAAACATGG + Intronic
924837679 1:247669177-247669199 TTTCACCAGATAGCCATAAATGG - Intergenic
1066231428 10:33438591-33438613 TTTCACCATATGTACAAAAATGG + Intergenic
1068117703 10:52752370-52752392 ATTCACCAGGTGCCCAAAAAAGG + Intergenic
1068647391 10:59482596-59482618 TTTAACCAGATTTCAAAGAATGG - Intergenic
1069054637 10:63831976-63831998 GTCCACCACATCTGCAAAAAAGG - Intergenic
1074090325 10:110247043-110247065 TTTCACCAGGTTTCCAATGAAGG - Intronic
1078232113 11:9453068-9453090 GGTCAACTGATTTCCAACAAGGG + Intergenic
1079551748 11:21707800-21707822 GTTCACAAGCTATCTAAAAAGGG - Intergenic
1081263950 11:40996040-40996062 GTTCATGAGATTTCCACAATAGG + Intronic
1085215923 11:74831854-74831876 GGTCAACTGATTTCCAACAAGGG + Intronic
1087859042 11:103130573-103130595 GTACACCAGACTTCTTAAAATGG - Intronic
1088116887 11:106322457-106322479 TTTCACCACATATGCAAAAAAGG + Intergenic
1092061567 12:5555337-5555359 GCTCACCAGATGTGCAAATAGGG + Intronic
1093139318 12:15489438-15489460 ATTCATGAGTTTTCCAAAAAGGG + Intronic
1093247577 12:16759274-16759296 GGTGACAAGATTTCCAAATATGG + Intergenic
1095790911 12:46166011-46166033 GTTCAACAGATTCATAAAAATGG + Intergenic
1095877984 12:47102881-47102903 CTTCACCATATATGCAAAAATGG - Intronic
1096019988 12:48316080-48316102 GTACACTAGATTCCCGAAAAGGG - Intergenic
1096436929 12:51599964-51599986 CTTCCCCAGATTTTCAAAATAGG - Intronic
1097418609 12:59346179-59346201 ATTCAACAGATTTACAAAAATGG - Intergenic
1099843550 12:87998815-87998837 GCTCAGCTGATTTTCAAAAAGGG + Intronic
1099855329 12:88157405-88157427 GATCACCATATTTACAAAAGGGG - Intronic
1100142851 12:91639941-91639963 ATTCATCATATTGCCAAAAAGGG - Intergenic
1100183568 12:92112029-92112051 GTTCATCAGATGTACAAAATAGG - Intronic
1101052423 12:100876738-100876760 GGTCAACTGATTTCCAACAAAGG - Intronic
1103424436 12:120820256-120820278 TTTCAACATATTTCCATAAAGGG - Intronic
1107346135 13:39462950-39462972 GCTCTCCAGTTCTCCAAAAAGGG + Intronic
1109683705 13:65785304-65785326 ATTCACTAAATTTCCAGAAAAGG - Intergenic
1109734536 13:66465041-66465063 TTTCACCAGATGTTCAAGAAAGG - Intronic
1110105146 13:71664623-71664645 GTGTACCACATTTTCAAAAATGG + Intronic
1110632914 13:77730314-77730336 GTTCACCAGATTTCCAAAAAAGG - Intronic
1111100397 13:83577050-83577072 GTTCAAAAGATTTCAAAAAAAGG + Intergenic
1111178959 13:84636583-84636605 CTGCACTAGTTTTCCAAAAATGG + Intergenic
1113272972 13:108695307-108695329 GTTCAACAGATTTTCAACAAGGG - Intronic
1113757128 13:112820340-112820362 GATGAACAGATTCCCAAAAACGG - Intronic
1114727361 14:24953313-24953335 GTTCACCATATTTGGAAAAAGGG - Intronic
1118636147 14:67750537-67750559 GTTCACCATTTTCCCAAACAGGG + Intronic
1118670965 14:68126705-68126727 GTGTACCTAATTTCCAAAAAAGG - Intronic
1119527203 14:75332313-75332335 ATTCTCCAGCCTTCCAAAAAGGG - Intergenic
1120566199 14:86061059-86061081 GTTCATTAGATTTCCAGAACTGG + Intergenic
1120874896 14:89366947-89366969 GATCACCATATTTCCATAACTGG + Intronic
1121176601 14:91895266-91895288 GCTCACCAGAAATCCACAAAGGG + Intronic
1122080078 14:99261040-99261062 GTTCACCCGATTCCAAAGAACGG + Intronic
1125133058 15:36306664-36306686 GGTCAACAGATTTTCACAAAGGG - Intergenic
1125563533 15:40657823-40657845 AGTGACCAGATTTCCAAATAAGG + Intronic
1127596154 15:60484270-60484292 GTTCCCCAGTTTACCAGAAATGG - Intergenic
1128985689 15:72219286-72219308 GTTCACCAGATTGTGAACAATGG + Intronic
1130170233 15:81504216-81504238 ATTAACCAGCTTTCCAAAGAGGG - Intergenic
1130634861 15:85608418-85608440 TTTCTCCAGAGTGCCAAAAATGG - Intronic
1132099260 15:99011804-99011826 GTTCCACAGTTTTCCACAAAAGG - Intergenic
1133848851 16:9482753-9482775 GTTTACCAGCCTCCCAAAAACGG - Intergenic
1134032544 16:11004141-11004163 ATTGACCAGAATTCCCAAAAAGG - Intronic
1135237595 16:20772644-20772666 ATTCAACAGATTTTCAACAAAGG - Intronic
1138274187 16:55719408-55719430 GTCCACTAGATTTCCAGGAATGG + Intergenic
1138334882 16:56245243-56245265 GCTCACCAGATTTCTAAGAATGG - Intronic
1139072451 16:63399903-63399925 GGTGAGCAGATCTCCAAAAAGGG + Intergenic
1140454743 16:75098515-75098537 GCCCCCCAGATTTCCCAAAAGGG + Intronic
1141288973 16:82699896-82699918 TTTCAACAGTTTTCCGAAAAAGG + Intronic
1142164168 16:88576875-88576897 TTTTGCCAGATTGCCAAAAACGG + Intronic
1142343547 16:89539105-89539127 GTAAACCACATGTCCAAAAAAGG - Intronic
1142891642 17:2947794-2947816 TTTCCCCAGCTTTCCAGAAACGG + Intronic
1144022223 17:11247484-11247506 ATTCACCATAATTTCAAAAATGG - Intronic
1144205882 17:12979336-12979358 GGTCACCAGGTTTCCTAAAGAGG - Intronic
1145180579 17:20747419-20747441 GTTCAGCAGTTTTACAAGAATGG - Intergenic
1145853493 17:28127973-28127995 GTTCACCTGATTTGCAAGAGAGG + Intronic
1146368931 17:32252155-32252177 GTTCAGCATAATTCCAAAATGGG - Intronic
1148729934 17:49827874-49827896 GGTCACCAGACCTCCAAATATGG + Exonic
1149210865 17:54298769-54298791 GTTCATCAAATTTAAAAAAATGG - Intergenic
1149840179 17:59956402-59956424 GTTCAGCAGTTTTACAAGAATGG - Intronic
1150117868 17:62570149-62570171 ATTCACCCTATTTCCAAATAAGG + Intronic
1150885586 17:69082022-69082044 GTTGACCAGATGTCCAAGATTGG + Intronic
1155566692 18:27143616-27143638 TTTCATCAGATTCTCAAAAAAGG - Intronic
1156959603 18:43009022-43009044 GTTTGCCACATTTCCAAATAAGG - Intronic
1157346103 18:46835142-46835164 GTTCAAAAGAATTCTAAAAATGG + Intronic
1158307072 18:56117501-56117523 ATTCACCACATTTCTAAAATGGG + Intergenic
1160428607 18:78795835-78795857 TTTCACCAGTTTTCCCAACAAGG - Intergenic
1162274888 19:9645240-9645262 GTTCACCATGTTGCCCAAAATGG + Intronic
1164935330 19:32205892-32205914 GTTCAAGAGATTGTCAAAAAGGG - Intergenic
1165191950 19:34071641-34071663 GATCAACTGATTTCCAACAAGGG + Intergenic
1166251464 19:41573804-41573826 GGTCTCCAGACTGCCAAAAAAGG + Intronic
1166582305 19:43912868-43912890 GTCCACGAGATCTGCAAAAATGG + Exonic
1167136272 19:47618043-47618065 ATTCACCACAGTCCCAAAAAGGG - Intronic
1167789984 19:51669309-51669331 CTTGACCAGATTTCCCAAAGAGG - Intergenic
1168033414 19:53699679-53699701 GTTCACCAGAGTTCCAGCACAGG - Intergenic
1168033740 19:53702397-53702419 GTTCACCTGAGTTCCAACATAGG - Intergenic
925511105 2:4626233-4626255 GTTCACGAGATCTCAAAATATGG + Intergenic
925816154 2:7752527-7752549 GGTCACCTGATTGCCAGAAATGG + Intergenic
926364565 2:12121424-12121446 GTTTACCAGATGCCCAAGAAGGG + Intergenic
926856539 2:17262542-17262564 GTTCACCAGCTTGCCTAGAATGG + Intergenic
931907704 2:66860378-66860400 GGGCACCAGATTGCCAAGAAAGG + Intergenic
932011750 2:67984984-67985006 GTTCAACTGATTTTCAACAAAGG + Intergenic
932913245 2:75827617-75827639 CTTCAACAGATTTACAAGAAAGG + Intergenic
933328192 2:80864582-80864604 AATCACTAGATTTCTAAAAATGG + Intergenic
933424433 2:82091712-82091734 TTTCCCCAGATATTCAAAAAGGG - Intergenic
935819934 2:106885058-106885080 GTTGATCAGAATTTCAAAAAAGG + Intronic
935852137 2:107234656-107234678 GTCCTCCAAATTTCCAAAGAAGG + Intergenic
936976384 2:118225566-118225588 CTTCAACAGAATACCAAAAAGGG - Intergenic
938192034 2:129292191-129292213 GTTCACGGGATTTCCACGAACGG + Intergenic
938638722 2:133257567-133257589 GTTCTCAATATTTACAAAAAAGG - Intronic
940394601 2:153173559-153173581 TTTAACCAAATTTCCAAATAAGG + Intergenic
942223780 2:173796948-173796970 GTCCACAGGATTTCCAGAAATGG - Intergenic
942468608 2:176235227-176235249 TTTCCCCAGATTTCAAAACAAGG - Intergenic
942808267 2:179962297-179962319 GTTCACAAGATTTTCAAAAGTGG + Intronic
942936688 2:181565388-181565410 GTTCACCTAATTTTAAAAAATGG + Intronic
945452293 2:210007666-210007688 GTTCATGAGATTTACAAAATAGG - Intronic
948580495 2:238984571-238984593 TTTCACCTGTTTTCCAAGAAAGG + Intergenic
1170474186 20:16698612-16698634 GCTCACAAGATTCCTAAAAAAGG - Intergenic
1174197524 20:48784179-48784201 GTGCACAAGAAGTCCAAAAACGG + Intronic
1177238186 21:18421010-18421032 GTACACTACATTTCTAAAAAGGG + Intronic
1179001126 21:37459283-37459305 TTTCACAAGTTTTACAAAAATGG - Intronic
1182807046 22:33081613-33081635 TTTCAGCAGATTCTCAAAAAGGG - Intergenic
1182987035 22:34729514-34729536 GTTCACCATGTTGTCAAAAATGG - Intergenic
1183112869 22:35664800-35664822 GTTCACCATTTTTTTAAAAAAGG - Exonic
1184845606 22:47083421-47083443 GTTAACCAGATTTGGAAAACAGG - Intronic
950622105 3:14214208-14214230 TATCCTCAGATTTCCAAAAAAGG + Intergenic
951046262 3:18041862-18041884 CTTCACTAGAATTCCAAACAGGG - Intronic
951062103 3:18221215-18221237 CTTCACCAGATTGCCAAAGAGGG - Intronic
956110215 3:65862812-65862834 CTTCACAAAATTTCCAAAAGAGG - Intronic
959258337 3:104043000-104043022 GTTAACCAGATTTCAGAAGATGG - Intergenic
959732138 3:109616856-109616878 AGTCACCATATTTGCAAAAATGG - Intergenic
963542752 3:146614991-146615013 GTTGCCAAAATTTCCAAAAAGGG - Intergenic
964090333 3:152868629-152868651 GTACAGCAGATTTCCAAGAGTGG - Intergenic
964778891 3:160313467-160313489 GTGTACCAGATTCACAAAAAGGG - Intronic
965069058 3:163893530-163893552 TAACACCAGTTTTCCAAAAATGG + Intergenic
967017104 3:185492405-185492427 GTTCACCTGTTTGCCAAAAGTGG + Intronic
971347787 4:25827257-25827279 GATCACCCTATTTCCAAATAAGG - Intronic
971736800 4:30463946-30463968 ATTCACTATATTTCCACAAATGG - Intergenic
971984046 4:33795935-33795957 ATTCACCAGACTTTAAAAAATGG - Intergenic
972367448 4:38389788-38389810 TCTCACCAGATTGCCAAAGAGGG - Intergenic
972524849 4:39898784-39898806 GGTCATCAGTTTTCCAAACATGG + Exonic
973148597 4:46860550-46860572 ATTCACCAGATGTCAAAGAAGGG - Intronic
973962592 4:56126645-56126667 TTTCATCAGATTTTCAAAATGGG - Intergenic
976079631 4:81340913-81340935 CTCCACCAGATGTACAAAAAAGG - Intergenic
979067462 4:116156493-116156515 ATTCATGAGTTTTCCAAAAAAGG + Intergenic
980796480 4:137690794-137690816 GCACACCCGATTTCCAAATAAGG + Intergenic
980920150 4:139076205-139076227 TTTGAACAGATTTCCATAAATGG - Intronic
983071431 4:163272235-163272257 TTTCACCATATCTCCAAATATGG + Intergenic
983886991 4:172990967-172990989 GGTCCCCTGAATTCCAAAAAGGG - Intronic
986878374 5:12138988-12139010 GTTCAACTGATGTCAAAAAATGG - Intergenic
987031764 5:13982944-13982966 GGTCTCCTGATTTCCCAAAAGGG + Intergenic
987631703 5:20480770-20480792 TTTCATCAGATTTAAAAAAATGG + Intronic
989788417 5:45360885-45360907 GTTACCCAGCTTTCCAAAAAAGG - Intronic
990106266 5:52266203-52266225 GTTTGCCTGATTTCCTAAAATGG + Intergenic
991015558 5:61928554-61928576 TTTCTCTAGATTTCCAAAACAGG + Intergenic
992131590 5:73698396-73698418 GGTCACCAGATTTCCATCAGAGG - Intronic
994220963 5:97194235-97194257 GTTCACTAGATAACTAAAAAGGG + Intergenic
994370957 5:98967108-98967130 GATAACCAGATTTTAAAAAATGG + Intergenic
994458168 5:100040847-100040869 CTTAACAATATTTCCAAAAATGG + Intergenic
995505254 5:112853492-112853514 GTAGAACATATTTCCAAAAATGG + Intronic
996449920 5:123609320-123609342 GTTCAGCAGATTGCAGAAAATGG + Intronic
1000996411 5:167963519-167963541 TTACACCACATTTTCAAAAATGG - Intronic
1001234030 5:170014479-170014501 ATCCACCAGATACCCAAAAAAGG - Intronic
1003683049 6:8274703-8274725 GTTTACCAGTTTTCCAACAATGG - Intergenic
1006164282 6:32055569-32055591 CTTCAACAGATTTCAAAAGAGGG + Intronic
1008921532 6:56848411-56848433 CTTCACCTCATTTCCTAAAAAGG + Intronic
1009489295 6:64267944-64267966 ATTAACCAAATTTCAAAAAAAGG - Intronic
1009766342 6:68080654-68080676 GTTCTTCAAATTTACAAAAATGG + Intergenic
1010301633 6:74267072-74267094 GTTCATCATCTTTCCACAAAAGG - Intergenic
1010533627 6:76996091-76996113 GTTTTCCAGATTGCCAAAGAAGG - Intergenic
1011121536 6:83959010-83959032 ATTCACCAGTTTTCAAAGAAAGG - Intronic
1011371639 6:86643238-86643260 GTTCAGCAGCATTCCAACAATGG - Intergenic
1011885368 6:92087721-92087743 GTTCATCTGATTTTCAAAATGGG - Intergenic
1012523895 6:100154199-100154221 GTTCAAAAGATTCCCAAAAGTGG + Intergenic
1012628626 6:101434822-101434844 GTTCACCATAATTCCTGAAAGGG + Intronic
1014006480 6:116425293-116425315 CTTCACTAGATTGCCAAAAGAGG + Intronic
1014485042 6:121988168-121988190 GGTCACCTGATTTACAACAAAGG - Intergenic
1015641904 6:135343594-135343616 GGTCACCTGATTTTCAACAAGGG + Intronic
1016758232 6:147710414-147710436 TTTCACCACATTTCTCAAAATGG - Intronic
1017066464 6:150533636-150533658 GTTCACCAGATTTTCTGCAATGG + Intergenic
1018124818 6:160671459-160671481 CTGCACCAGTTTTCCAACAAGGG + Intergenic
1018717227 6:166542910-166542932 GTTCACCTCATTTCCAAAAAAGG + Intronic
1020238649 7:6375101-6375123 TTTGACCATTTTTCCAAAAAGGG + Intronic
1020813717 7:12877866-12877888 ATTTACCAGATTTCCAAAGAAGG - Intergenic
1020927229 7:14345637-14345659 GTTCATCACATTTTAAAAAACGG + Intronic
1023011895 7:35931276-35931298 ATTCTCCAGAATTCTAAAAAGGG + Intergenic
1023304610 7:38812257-38812279 GTTAACCAATTTTCCACAAAGGG + Intronic
1023917419 7:44600382-44600404 GGTCAACTGATTTTCAAAAAGGG + Intergenic
1024079240 7:45842592-45842614 ATTCTCCAGAATTCTAAAAAGGG - Intergenic
1025125540 7:56341357-56341379 ATTCTCCAGAATTCTAAAAAGGG + Intergenic
1029556196 7:101271075-101271097 ATTCTCCAGAATTCTAAAAAGGG + Intergenic
1030307409 7:108033064-108033086 GTTCACCATATTTTTAGAAATGG + Intronic
1030654207 7:112148349-112148371 CTTCACCAGCTTTCCAAAGGGGG - Intronic
1031508125 7:122612899-122612921 GGTCAACTGATTTTCAAAAAAGG + Intronic
1031758090 7:125672600-125672622 GTTTACCAGATTAAAAAAAATGG - Intergenic
1031819692 7:126484823-126484845 CTTACCCAGCTTTCCAAAAATGG - Intronic
1032521503 7:132549055-132549077 ATTCATGAGATTTCCAGAAAAGG - Intronic
1033137007 7:138794007-138794029 GTTCTCAAGGTTTCCTAAAAGGG + Intronic
1033397728 7:140991937-140991959 TTCCACCAGAATTCCTAAAAGGG + Intergenic
1035229468 7:157455383-157455405 GGTCAACTGATTTCCAACAAGGG - Intergenic
1035235034 7:157491426-157491448 GGTCAACTGATTTCCAACAAGGG - Intergenic
1037122237 8:15302608-15302630 GTTAACCAGAATTCAAGAAAGGG + Intergenic
1038693603 8:29785119-29785141 GTTGACCAGATTTGGAAAAGGGG + Intergenic
1039163728 8:34652252-34652274 GTTCAACTGATTTTCAACAAAGG + Intergenic
1039422721 8:37457321-37457343 GTTTAACAGAGTTCCAAAACAGG - Intergenic
1039908542 8:41805754-41805776 GTTAAACAGATTTGCAAAAATGG - Intronic
1041345473 8:56892551-56892573 ATTCATCAGATTTTTAAAAAGGG + Intergenic
1041828064 8:62120858-62120880 GATCACCAGATTTTTTAAAAAGG + Intergenic
1043287694 8:78554683-78554705 TTTCACCAGCTTTCTAAGAAAGG + Intronic
1046987720 8:120407998-120408020 TGTCACCAGATTTCCTGAAATGG - Intronic
1047690428 8:127347436-127347458 GTAAACCATATATCCAAAAAGGG - Intergenic
1049132182 8:140856016-140856038 TTTAAGCAGATTTTCAAAAAAGG + Intronic
1051129720 9:13846755-13846777 TTTCCCCAGATCTCCACAAAAGG + Intergenic
1054927975 9:70607244-70607266 TCTCACCAGATTTTCAAAAATGG - Intronic
1057300875 9:93880981-93881003 GTTAACCAGATTTCAGAAGATGG - Intergenic
1058472436 9:105294255-105294277 ATTTAAAAGATTTCCAAAAATGG - Intronic
1059973572 9:119692670-119692692 GTACACCAGACTTCCAGAATTGG - Intergenic
1061844509 9:133379550-133379572 GGTCACCAGTTTTACCAAAAGGG + Intronic
1186077521 X:5897456-5897478 CTGCAGCTGATTTCCAAAAACGG + Intronic
1189361187 X:40353404-40353426 TTTCAACAAATTTCAAAAAATGG + Intergenic
1190246297 X:48692758-48692780 ATTCACCAGATTTCAGAAATCGG - Intergenic
1190422969 X:50304110-50304132 GGTCAACTGATTTCCAAGAAGGG - Intronic
1194605374 X:95972936-95972958 GGTCACCAGACCTCCAAATATGG - Intergenic
1194765052 X:97839797-97839819 GGAAACAAGATTTCCAAAAAAGG - Intergenic
1194870467 X:99125367-99125389 GTTCCTTAGTTTTCCAAAAATGG - Intergenic
1196309537 X:114146803-114146825 GTACATCACATTTCCAACAAAGG + Intergenic
1196436472 X:115679342-115679364 GTTCATTAGATTTCACAAAAGGG + Intergenic
1196633781 X:117975823-117975845 GTTTTCCAAATTCCCAAAAAGGG + Intronic
1196913399 X:120507545-120507567 ATGCATCAGATTACCAAAAATGG - Intergenic
1198124509 X:133629311-133629333 TTTCCCCATATGTCCAAAAAAGG + Intronic
1202016253 Y:20409792-20409814 GATCACTAGGTTTCCAAATATGG + Intergenic