ID: 1110633322

View in Genome Browser
Species Human (GRCh38)
Location 13:77735826-77735848
Sequence AAGAAGAGTTAGATGGGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 245}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110633322_1110633327 -4 Left 1110633322 13:77735826-77735848 CCAGACCCCATCTAACTCTTCTT 0: 1
1: 0
2: 3
3: 14
4: 245
Right 1110633327 13:77735845-77735867 TCTTCTCAGGACCTTCCCTGTGG 0: 1
1: 0
2: 1
3: 26
4: 286
1110633322_1110633331 15 Left 1110633322 13:77735826-77735848 CCAGACCCCATCTAACTCTTCTT 0: 1
1: 0
2: 3
3: 14
4: 245
Right 1110633331 13:77735864-77735886 GTGGTTTCTAAAATCTCCAGTGG 0: 1
1: 0
2: 0
3: 16
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110633322 Original CRISPR AAGAAGAGTTAGATGGGGTC TGG (reversed) Intronic
903991966 1:27278580-27278602 AAGATGAGCAAGATGGGCTCAGG - Intronic
904161318 1:28524141-28524163 AGGCAAAGTTAGATGGGGTAGGG - Intronic
904560506 1:31394309-31394331 AAGAAGAGTTTCTTGAGGTCTGG - Intergenic
905029784 1:34874245-34874267 AGGGAGAGTTAGTTGAGGTCTGG - Intronic
905812239 1:40921217-40921239 AAGAAGAGATGAATGTGGTCTGG - Intergenic
907166894 1:52420046-52420068 AAAAAGAATTAAATGGGGTCAGG + Exonic
911994172 1:104742567-104742589 AAGGAGAAAGAGATGGGGTCTGG - Intergenic
913977813 1:143478181-143478203 CACAACAGATAGATGGGGTCAGG + Intergenic
914072217 1:144303810-144303832 CACAACAGATAGATGGGGTCAGG + Intergenic
914106938 1:144662546-144662568 CACAACAGATAGATGGGGTCAGG - Intergenic
914816100 1:151063718-151063740 AAGAAGCATTAGTTGTGGTCGGG - Intronic
916403810 1:164477088-164477110 AAGAACAGTGAGATCTGGTCGGG + Intergenic
917505229 1:175621362-175621384 AAGGAGGGTCAGATGGGGCCAGG - Intronic
918341177 1:183569048-183569070 AAGAAGATGAAGGTGGGGTCAGG - Intronic
918354189 1:183690433-183690455 AGGAAGAATTCGATGGGGTAGGG + Intronic
919831209 1:201541355-201541377 AAAAAGAAGTAGAGGGGGTCTGG - Intergenic
919850041 1:201666416-201666438 AAGAAAAGACAGATGGGGTGGGG + Intronic
920000460 1:202794915-202794937 AATAAAAGTTACATGGGGCCGGG + Intronic
920738790 1:208560384-208560406 AAGGAGAGTTGGAAGGGATCTGG + Intergenic
921325508 1:213983537-213983559 AAGGGGAGTGAGATGGGGTGAGG - Intronic
923494379 1:234511709-234511731 AAGAAGGGTTGGTTGGGGACTGG - Intergenic
923627005 1:235622416-235622438 AAAAAGAGTTAGATGAGGCTGGG + Intronic
923905071 1:238375453-238375475 AGGAAGACTTAGTTGGAGTCTGG + Intergenic
1063276325 10:4572401-4572423 AAGAAGAGATGCATGGGGTGAGG + Intergenic
1063429338 10:5976178-5976200 AAGCAGAGTTAGTTGGTGACCGG - Intronic
1064271906 10:13872889-13872911 AAGGATAGTTAGATGGAGCCTGG + Intronic
1065086056 10:22178196-22178218 AAGAAGAAATAGCTGGGGCCAGG + Intergenic
1066632608 10:37471591-37471613 AAGAAGACTTAGATGTGATGTGG + Intergenic
1067281278 10:44875090-44875112 AAGAAGAGGTAGATGGGAAGTGG + Intergenic
1067342434 10:45416742-45416764 AAGAAGAGGTGGATGGGGGATGG + Intronic
1067493535 10:46739821-46739843 AAGAGGAGTTGGATGGCATCTGG - Intergenic
1067601125 10:47600583-47600605 AAGAGGAGTTGGATGGCATCTGG + Intergenic
1067741088 10:48896681-48896703 AACCAGAGTTAGGAGGGGTCAGG - Intronic
1067802155 10:49366333-49366355 AAGGAGAGTCCCATGGGGTCTGG + Exonic
1067936096 10:50613376-50613398 GAGATGAGTGCGATGGGGTCTGG - Intronic
1069106757 10:64392902-64392924 AAGAAGTGTTAGATGGTGTGTGG + Intergenic
1069223475 10:65911797-65911819 TAGCAGAGTCAGATGGTGTCTGG + Intergenic
1071652668 10:87408455-87408477 AAGAGGAGTTGGATGGCATCTGG + Intergenic
1076811976 10:132891302-132891324 AAAACGAGTTTGGTGGGGTCGGG + Intronic
1078191560 11:9095677-9095699 GAGGAGAGCTAGCTGGGGTCTGG + Intronic
1078471797 11:11593564-11593586 AAAAAAAATTAGATGTGGTCTGG - Intronic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1078848207 11:15140732-15140754 AAGAAAAATTAGATGGGGCATGG - Intronic
1079875216 11:25847820-25847842 AAAATGAGTTAGATGGAGTGTGG + Intergenic
1081375134 11:42349614-42349636 AAGAAGAGTTATATATGGTGTGG - Intergenic
1082794037 11:57367313-57367335 AAGCAGAGTGAGCTGGGCTCTGG + Intronic
1084695210 11:70749037-70749059 AAGAGCAGTCAGATGGGCTCAGG + Intronic
1085307560 11:75496587-75496609 AACATGAGGGAGATGGGGTCTGG - Intronic
1085446963 11:76607261-76607283 ACAAAGAGTGAGATGGGGCCTGG - Intergenic
1085537464 11:77231809-77231831 AAGGGGAGTTATATGGGGACAGG + Intronic
1085889087 11:80556547-80556569 AAGAAGGATCAGAGGGGGTCTGG - Intergenic
1091658703 12:2364696-2364718 AGGAAGAGTTAGTTGGGGTGAGG + Intronic
1092013678 12:5138804-5138826 AACAAGGGAGAGATGGGGTCTGG - Intergenic
1093051931 12:14514072-14514094 ATTAAGAGTTAGTTGGGGCCGGG - Intronic
1093244747 12:16722400-16722422 AGGAAGAGTTATTAGGGGTCAGG + Intergenic
1094059537 12:26299120-26299142 AAGTAGAGTAAGATTGGGTGAGG + Intronic
1094232017 12:28116642-28116664 AAGAAGAATAAGCTGGGGGCAGG + Intergenic
1097168243 12:57097027-57097049 AAGAAGAGGCACATGGGGTCAGG + Intronic
1097214948 12:57403511-57403533 AAAAAGAGCAAGATGGGGCCTGG + Intronic
1097593560 12:61600698-61600720 AGGAAGAGTTGACTGGGGTCCGG - Intergenic
1097866147 12:64560656-64560678 AACAAGAGTAAGATGGGGTTTGG - Intergenic
1098375639 12:69810672-69810694 AAGAAAAGTTAGATTGGGGTGGG + Intronic
1100754450 12:97734959-97734981 ATGAAGAGGTGTATGGGGTCAGG + Intergenic
1101786378 12:107887150-107887172 ATGAAGAGTTGGAGGGGCTCTGG + Intergenic
1102910633 12:116711236-116711258 AAGAATAGTGAGATGTGGCCAGG + Exonic
1103565393 12:121812701-121812723 AAGAAGAGACAGACGGGCTCGGG - Intronic
1105066728 12:133207511-133207533 AAAAAGAGATATATGGGGCCAGG + Intergenic
1107012972 13:35685858-35685880 ATTAAGAGTTAGGTGGGGGCTGG - Intergenic
1107890896 13:44913386-44913408 AAGATGGGCAAGATGGGGTCAGG + Intergenic
1108601383 13:51998071-51998093 AAGAAGGATTAGATGGTGCCGGG - Intronic
1110633322 13:77735826-77735848 AAGAAGAGTTAGATGGGGTCTGG - Intronic
1113498832 13:110757142-110757164 AAGAAAAGTTAGCTAGGTTCAGG + Intergenic
1114627570 14:24139330-24139352 AAGAAGAGGTAGAGGGAGTGGGG + Intronic
1114901780 14:27070178-27070200 AACAAGATCAAGATGGGGTCTGG + Intergenic
1115215537 14:31010384-31010406 AAAAATAGTTATATGGGGTGGGG - Intronic
1119085778 14:71737562-71737584 AAGAAGTGTGAGCTGGGGTACGG - Intronic
1119427942 14:74547864-74547886 CAGAAGGGTTAGGTGGGGCCAGG - Intronic
1121331751 14:93053977-93053999 AAGTAGGGAGAGATGGGGTCGGG + Intronic
1122123768 14:99568388-99568410 AGGAGGAGTTAGGAGGGGTCTGG - Intronic
1122646927 14:103201052-103201074 CAGAAGAATTAGGTGGGGTGGGG - Intergenic
1124820484 15:33040590-33040612 AATAAGAGTTAGATATGATCTGG + Intronic
1125950767 15:43749496-43749518 AGTAAGAGTAAAATGGGGTCTGG + Intronic
1126630757 15:50732178-50732200 TGGAAGAGTTAGAAGGGGTGAGG + Intronic
1131877945 15:96830766-96830788 AAGAAGTGTTAAAGGGGATCAGG + Intergenic
1134259996 16:12643477-12643499 TAAAACAGTTAGATGGGGGCTGG + Intergenic
1135972009 16:27079117-27079139 AAGCAGAGTTACCTGGGGGCAGG + Intergenic
1136468124 16:30459192-30459214 AAGTAGAGTAAGCTGGGGTGTGG - Intergenic
1138444231 16:57053420-57053442 AGGAAGAGAGAGATGGGCTCGGG + Intronic
1139669300 16:68481124-68481146 CAGAAGAGTCAGGTGGTGTCAGG + Intergenic
1139845606 16:69919137-69919159 AAGAAAATTTAAATGTGGTCGGG - Intronic
1139871698 16:70113745-70113767 GAGAAGAGTAAGATAGGGCCGGG + Exonic
1140364236 16:74368738-74368760 GAGAAGAGTAAGATAGGGCCGGG - Intergenic
1140766632 16:78165528-78165550 GAGAAGGGTCAGATGGGGTAGGG + Intronic
1142647931 17:1327462-1327484 AAGAAGAGATATAGGGGGCCTGG + Intergenic
1144780137 17:17803934-17803956 CTGAAGAGTGAGATGGGGCCTGG - Intronic
1146983574 17:37190131-37190153 AGAAAGAGTTAGAAGGGGCCAGG + Intronic
1149819179 17:59758527-59758549 TAGAAAAATTAGATGGGGCCAGG + Intronic
1152958848 18:64799-64821 GGGAAGAGTTTGATGAGGTCTGG - Intronic
1153020990 18:628960-628982 AAAAATAGTCAGATAGGGTCAGG - Intronic
1155132460 18:22951859-22951881 ATGAAGAGATACATGGGGTGAGG + Intronic
1155473343 18:26213325-26213347 AAGAAGTGTTAGCTGGTGGCTGG - Intergenic
1155546526 18:26921551-26921573 AAATGGAGTTAGATGGGGGCTGG - Intronic
1155644047 18:28055499-28055521 AAGAAGAGTTATTTGGAGACTGG + Intronic
1156333251 18:36145768-36145790 AAGAAGAGATAAATGGGTTGTGG - Intronic
1156745905 18:40390809-40390831 AAGAAGAGTAAGATATAGTCAGG - Intergenic
1163715839 19:18871515-18871537 AAAAAAAGTTAGCTGGGGCCAGG - Intronic
1164454453 19:28395646-28395668 TAGAAGAGTGAGATGGGGCCAGG + Intergenic
1165420626 19:35720370-35720392 AAGAAGAGTTGGATCTGGACAGG + Exonic
1167062813 19:47160939-47160961 TAGGAGAGTTAGTTGGGGTGGGG + Intronic
1167436015 19:49479122-49479144 AATATGAGAAAGATGGGGTCTGG - Intronic
1167795828 19:51707868-51707890 ATGAAGAGGTAGATAGGGTGAGG + Intergenic
1202644774 1_KI270706v1_random:130089-130111 AAGAACAGTATGATGGGGTGTGG - Intergenic
925761299 2:7187203-7187225 AGGTAGAGTGAGAAGGGGTCAGG + Intergenic
928289737 2:30026719-30026741 GGGAAGAGTTAGATGGTCTCTGG - Intergenic
929608353 2:43250984-43251006 AACAAGAGTGAAAAGGGGTCAGG + Intronic
929995793 2:46825651-46825673 AAGAAGAGTCAGATGGGTGGGGG - Intronic
930692979 2:54383316-54383338 AACATGATTTAGATGGGATCAGG - Intronic
933365205 2:81344807-81344829 AAGATGAGGCAGATGGGGTAGGG + Intergenic
934292816 2:91713379-91713401 CACAACAGATAGATGGGGTCAGG + Intergenic
934687475 2:96332391-96332413 ATGAAGAGTAAAATGGGGTGGGG + Intergenic
937022543 2:118671498-118671520 AGGAAGAATTGGATGGGGGCTGG + Intergenic
937035984 2:118782345-118782367 AAGAAAAGATAGATGGGTGCAGG - Intergenic
937554568 2:123137654-123137676 AAGCAGACTTTGATGTGGTCAGG + Intergenic
938579862 2:132636148-132636170 AAGAAGTGGTAGCTGGTGTCTGG + Intronic
938615497 2:132993563-132993585 GGGAAGAGCTGGATGGGGTCTGG - Intronic
938642133 2:133292073-133292095 AAGAAGAATGGGATGGGGTTGGG + Intronic
939588116 2:144030214-144030236 AAGAAGATTTAGATGGGGTAGGG - Intronic
944083678 2:195819552-195819574 AAGAAGAGTAAGATACAGTCTGG + Intronic
947204314 2:227646224-227646246 ATGAAGAGTTAGATGGTTTAAGG - Intergenic
947559885 2:231139832-231139854 AAAAAGAGTTGAATGGGGTAAGG + Intronic
947938625 2:234028629-234028651 GAGAAGAGTTAGAGGAGGGCAGG - Intergenic
948022930 2:234751754-234751776 AGGGACAATTAGATGGGGTCTGG + Intergenic
948213970 2:236215279-236215301 CAGAAGGGCTAGATGGGGGCCGG - Intronic
1172358020 20:34293109-34293131 AGGAAGAATGAGATGGGGTATGG - Intronic
1172919476 20:38469150-38469172 AACAAGAGTCACATGGGATCTGG + Intergenic
1173146071 20:40525417-40525439 AGGAAGTGTTAAATGGGGACGGG - Intergenic
1177348650 21:19905336-19905358 AAGAAGAGTTAGATGGATAATGG + Intergenic
1177866340 21:26517480-26517502 AAGAAGACTCAGATGGGGAATGG + Intronic
1177886083 21:26747374-26747396 CAGAAGAGTTTGATGAGGTCAGG + Intergenic
1182042686 22:27250634-27250656 AAGAAGCAAGAGATGGGGTCAGG + Intergenic
1182312653 22:29420324-29420346 AAAAAGAGAGAGAAGGGGTCAGG - Intronic
1182626954 22:31654511-31654533 AAGGTGAGTTAGAGAGGGTCGGG - Intronic
1184613299 22:45619918-45619940 AAGAAGACCTAGATAAGGTCAGG - Intergenic
1185304476 22:50106308-50106330 AAAAAGAATTAGTTGGGGTGTGG - Intronic
954518894 3:51205356-51205378 ATGAAGACTTTGATGGGGTTAGG + Intronic
956239064 3:67108678-67108700 GGGAAGAGTGAGATGGGGTTGGG - Intergenic
959830706 3:110858291-110858313 AAGAAGAATAAGATGGGTGCAGG + Intergenic
961018787 3:123486793-123486815 ATGGAGAGTGGGATGGGGTCGGG + Intergenic
961437535 3:126929857-126929879 TAAAAGAGTTGGAAGGGGTCAGG - Intronic
961840147 3:129703446-129703468 AAGTACAGTAAGATGGGGTTGGG + Intronic
963241671 3:143009300-143009322 AGAAAGAGTGAGATGGGGCCGGG + Intronic
965668028 3:171116972-171116994 AGGAACAGTTGCATGGGGTCAGG + Intronic
966314493 3:178630523-178630545 AACTAGAGTTACATTGGGTCTGG + Intronic
967157312 3:186705394-186705416 AGGAAGAGTTAGTTGGGGATGGG - Intergenic
967323467 3:188216559-188216581 GAGCAGAGTTAGGTGGGGTGTGG - Intronic
971095981 4:23403701-23403723 AAAGGGAGTGAGATGGGGTCGGG - Intergenic
972267280 4:37473902-37473924 GAGTTGAGTTGGATGGGGTCTGG - Intronic
974056528 4:56988484-56988506 AAAAAGAGATAGACAGGGTCTGG - Intronic
974162622 4:58159316-58159338 AAGAAGAATTAGAGGTGGGCTGG - Intergenic
974505912 4:62771956-62771978 AAGAAGAGCTGGAAGGGGTATGG - Intergenic
975261273 4:72302540-72302562 AAGAAGAGAAAGATGGGGTGGGG + Intronic
975682722 4:76892715-76892737 AAGATGAGTAAGAGGGTGTCAGG + Intergenic
976144831 4:82032321-82032343 AAGAAGAATGAGCGGGGGTCGGG + Intronic
976598308 4:86914834-86914856 AAGGAGAGAAAGCTGGGGTCGGG + Intronic
977794092 4:101141666-101141688 AAGAAGAGATAGAAAGTGTCAGG - Intronic
979843616 4:125478973-125478995 AAGAATAGTTAGATATGTTCAGG - Intronic
980267286 4:130533785-130533807 AAAAATAGTTAGATGAGGTATGG - Intergenic
981102258 4:140842164-140842186 AGGAAGAATTACTTGGGGTCAGG - Intergenic
981914876 4:150022898-150022920 AACAAGAGATAGATGGGCCCTGG - Intergenic
982390587 4:154858995-154859017 AAGAAGAGGCAGATGATGTCAGG + Intergenic
983625315 4:169796328-169796350 CAAAACAGTTGGATGGGGTCGGG - Intergenic
984434188 4:179686930-179686952 AATTAGGGTTAGATGAGGTCAGG + Intergenic
987555163 5:19437073-19437095 AAAAAGAGGTAGTTGGGTTCTGG - Intergenic
988597852 5:32611340-32611362 AAGGAGAGTTTGGTGGGGTAGGG + Intergenic
989399589 5:40994390-40994412 AAGAAGACTTTGATGGGGTCTGG + Intergenic
990222166 5:53604867-53604889 AAGAATAGGTAGATGGTGACCGG - Intronic
990442410 5:55860071-55860093 AATAAAAGTTAGGTGAGGTCTGG + Intronic
991957882 5:72014102-72014124 AAGAAGAGATGGAGGGGGGCAGG + Intergenic
992243990 5:74798954-74798976 AAGGAGAGAAAGCTGGGGTCGGG - Intronic
992410845 5:76503886-76503908 AAGAAAAGTAAGCTGAGGTCAGG - Intronic
994111282 5:96007608-96007630 AAGAAGAGGAAGATGGGGCCGGG + Intergenic
996015642 5:118531294-118531316 AGGATGAGGTAGATGGGGTAGGG - Intergenic
998225463 5:140323168-140323190 AAGATGAGGTGGAGGGGGTCAGG + Intergenic
998918617 5:147042978-147043000 AAGAGGAGTTAGAGGAGATCAGG + Intronic
1001180584 5:169516344-169516366 CAGAATAGTAAGATGGGGTCAGG + Intergenic
1002975799 6:2074797-2074819 AGGAAGACTTAAATGTGGTCAGG - Intronic
1003861523 6:10326598-10326620 TAGAAAAGTCAGATGGGGCCGGG + Intergenic
1006479027 6:34277013-34277035 AGGAAAGGTTAGCTGGGGTCAGG - Intergenic
1007850886 6:44801740-44801762 AAGGAGACCGAGATGGGGTCAGG + Intergenic
1008318401 6:50075940-50075962 AAGAAGAGATAGAGAGGGTAGGG + Intergenic
1008537051 6:52514378-52514400 AGGAAGAGTTGGCGGGGGTCGGG + Intronic
1008742222 6:54623286-54623308 ATGAAGAGATACATGGGGTGAGG - Intergenic
1010399033 6:75427470-75427492 AAGAAGACTCATATGGGGCCTGG + Intronic
1011250658 6:85368545-85368567 AATAAGATTTGGATGGGGTGAGG - Intergenic
1012599991 6:101083878-101083900 AAGAAGAGTAAGATCAGGCCTGG - Intergenic
1012841084 6:104329922-104329944 AAGAAGAGGAAGATTGGGTTGGG - Intergenic
1012854080 6:104480561-104480583 AAGAAGAAATAGATGGGGTCGGG + Intergenic
1012908290 6:105092310-105092332 AAGAAAAGTTAGAAGAGATCAGG + Intergenic
1012969346 6:105710907-105710929 AAGAGTAGTTTGATGGTGTCTGG - Intergenic
1015338995 6:132075886-132075908 AAGAGCAGTAAGATGAGGTCAGG + Intergenic
1015370062 6:132440362-132440384 AAGAACACTTTCATGGGGTCTGG - Intergenic
1015792311 6:136975920-136975942 AAGAAAAGTAAAATGGGGTGGGG - Intergenic
1017332817 6:153219286-153219308 AGAAAGAGTGAGATGGGGTGAGG + Intergenic
1018441810 6:163820587-163820609 AAGAAGAGAGAGATCCGGTCAGG - Intergenic
1019099894 6:169621035-169621057 ATGAAGAGTTAGATGAAGTGAGG - Intronic
1025034950 7:55588147-55588169 ATGAAGAGTTGGATGGAGACAGG + Intergenic
1025791212 7:64688551-64688573 AAGAAGAGGAAGAAGGGGTTGGG - Intronic
1026906507 7:74065919-74065941 GAGAAGAGGCAGGTGGGGTCAGG - Intronic
1027456182 7:78394539-78394561 GAGAAGAGTTAGATGGGAGAGGG - Intronic
1027469884 7:78560214-78560236 AAACAGATTTAGATGGGGTTAGG + Intronic
1028125518 7:87108299-87108321 AAGAAGAGCTGCATGGGATCTGG + Intergenic
1029586328 7:101474156-101474178 CAGATGAGAAAGATGGGGTCAGG + Intronic
1030435190 7:109508955-109508977 AAGAAAAGTTCTATGGGGTGGGG - Intergenic
1031210197 7:118815027-118815049 ACCAAGAGTTAAATTGGGTCTGG - Intergenic
1032245242 7:130205831-130205853 AAAAAAAATTACATGGGGTCAGG - Intronic
1033010527 7:137617611-137617633 AAGATGGGGTAGATGGGGTGAGG + Intronic
1033508657 7:142031768-142031790 AAGTAGAGTTTGATGGAATCTGG + Exonic
1034237679 7:149585389-149585411 GAGAAGAGGTTGATGGGATCAGG - Intergenic
1034624466 7:152482026-152482048 AAGAAAACTTAGCTGGGGGCTGG + Intergenic
1036108125 8:5864361-5864383 AAGTAGAGTTAGTTGAGGACAGG - Intergenic
1037419425 8:18686679-18686701 AAGAAGAGTGAGAAGCGGTTGGG - Intronic
1039437245 8:37568146-37568168 AAGAGCAGTTCCATGGGGTCGGG - Intergenic
1039652570 8:39358252-39358274 ATGAAGAGATAGATGGTGGCCGG + Intergenic
1041278802 8:56190764-56190786 AAGAAGAGATAGAGGAGGACAGG + Intronic
1042654985 8:71085944-71085966 ATGAAGAGTTAGATGGAATTAGG + Intergenic
1043079075 8:75742102-75742124 TAGAAAAGTAAGAAGGGGTCAGG - Intergenic
1044552187 8:93524770-93524792 ATGATGAGTGACATGGGGTCTGG + Intergenic
1045501359 8:102746680-102746702 AAGAAGAGGAAAATGGGGTGAGG + Intergenic
1047487735 8:125347490-125347512 AAGAGGAATAAGATCGGGTCTGG - Intronic
1051031716 9:12688493-12688515 ATGAAGAGGTAGAAGGGGTCAGG + Intronic
1051055298 9:12978175-12978197 GAGAAGAGGGAGATGAGGTCAGG - Intergenic
1051067474 9:13121976-13121998 AAGGAGAGTTAGGTGGGGAAGGG + Intronic
1053227832 9:36376628-36376650 AAAGAGAGTTACATGGGGCCGGG + Intronic
1053273321 9:36765196-36765218 AAGATGAGTTAGAAGGGGACAGG + Intergenic
1055036425 9:71823166-71823188 CAGAATAATTAGATGGGGCCAGG - Intergenic
1058491681 9:105508157-105508179 AAAAAGAGTGATATGTGGTCGGG - Intronic
1058845231 9:108950934-108950956 AAGAATAGGTAGATGGGAGCTGG - Intronic
1060240021 9:121894979-121895001 AAGAAAAGTCAGCGGGGGTCAGG + Intronic
1061729575 9:132603387-132603409 AAGAAGAGTGTGGAGGGGTCCGG + Intronic
1061852238 9:133423069-133423091 AAAAAGAGATGGATGGGGCCGGG - Intronic
1062545308 9:137060228-137060250 AAGAATAGTTAATAGGGGTCTGG - Intergenic
1203743519 Un_GL000218v1:23259-23281 ATGCAGAGTTAGATATGGTCTGG + Intergenic
1185820405 X:3197511-3197533 ACGTAGAGTTAGATAGGCTCTGG + Intergenic
1185976849 X:4730916-4730938 AATCAGAGTTAGAAGGGGTTGGG - Intergenic
1186077711 X:5898521-5898543 AAGATGAAGTGGATGGGGTCTGG - Intronic
1188215481 X:27471443-27471465 AAGAAAGGTGAGATGGGGTGAGG - Intergenic
1188889114 X:35587761-35587783 AAAGAGAGCTAGATTGGGTCTGG - Intergenic
1189217678 X:39341012-39341034 AAGAAGAGGGAGAAGGTGTCAGG + Intergenic
1189650840 X:43187938-43187960 AAGAAGAAGTAGAAGGGGGCAGG + Intergenic
1193428942 X:81376469-81376491 AATTAGAGTTAGATGAGGTCAGG - Intergenic
1195086058 X:101415758-101415780 AAGAAGACTCAGAAGGGCTCTGG + Intergenic
1195769026 X:108329055-108329077 AAGAAGAGTGGGAAGGGGGCTGG + Intronic
1196415961 X:115471508-115471530 AATTAGGGTTAGATAGGGTCCGG + Intergenic
1197170643 X:123430025-123430047 AATAAGTGGGAGATGGGGTCTGG - Intronic
1197996439 X:132380557-132380579 AAGAAGGGCTAGCTGGGGTCTGG + Intronic
1199054979 X:143283011-143283033 AAGTAGAGTAAGATGAAGTCAGG + Intergenic
1199261730 X:145782086-145782108 CACAAGAGTTAGATGGGGGAAGG - Intergenic
1199317971 X:146402278-146402300 CAGCAGAGTTAGCTGGGCTCAGG + Intergenic
1199896628 X:152133116-152133138 AAGAAAAGTAAGACGGGGTGAGG - Intergenic
1200080613 X:153574567-153574589 AGGAAGAGTGAGAAGGTGTCAGG + Intronic
1202381387 Y:24278471-24278493 AAGCAGGGTGAGGTGGGGTCAGG + Intergenic
1202489398 Y:25391655-25391677 AAGCAGGGTGAGGTGGGGTCAGG - Intergenic
1202579589 Y:26365858-26365880 CAGTAGAGATAGATGGGGCCTGG + Intergenic