ID: 1110633410

View in Genome Browser
Species Human (GRCh38)
Location 13:77736646-77736668
Sequence CAGATTCAGCAGAAGACATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 241}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110633410_1110633411 -10 Left 1110633410 13:77736646-77736668 CCTTATGTCTTCTGCTGAATCTG 0: 1
1: 0
2: 0
3: 18
4: 241
Right 1110633411 13:77736659-77736681 GCTGAATCTGCTCTCATCAGTGG 0: 1
1: 0
2: 0
3: 15
4: 121
1110633410_1110633412 -5 Left 1110633410 13:77736646-77736668 CCTTATGTCTTCTGCTGAATCTG 0: 1
1: 0
2: 0
3: 18
4: 241
Right 1110633412 13:77736664-77736686 ATCTGCTCTCATCAGTGGCCTGG 0: 1
1: 0
2: 3
3: 13
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110633410 Original CRISPR CAGATTCAGCAGAAGACATA AGG (reversed) Intronic
901474064 1:9477028-9477050 CAGATTCAGCAGATGTCCTGAGG - Intergenic
901474086 1:9477150-9477172 CAGATTCAGCAGATGTCCTGAGG - Intergenic
902220701 1:14962774-14962796 CAGATCCAGAAGAGCACATAGGG - Intronic
902443420 1:16446244-16446266 AGGATTCAGTAGAAGATATATGG + Intronic
903395407 1:22998182-22998204 GAGATTAATCAGAAGACACAAGG + Intergenic
903864202 1:26386364-26386386 CAGTGTCAGCAGAAGTCTTAGGG + Intergenic
904149144 1:28422655-28422677 CAGATACAGGAAAAGAAATATGG - Intronic
904577224 1:31512790-31512812 CAGATTCAACACAAGCCAAAGGG + Intergenic
906318486 1:44802871-44802893 CAGGTTCAGCAGCAGACAGGTGG + Intronic
906883338 1:49617244-49617266 CATATGAAGCAGAAGACACAGGG - Intronic
907064060 1:51462041-51462063 CTGCTTCAGCAGATTACATAGGG - Intronic
908290762 1:62664902-62664924 CAGATTCAGGAGAGGGCAAAGGG + Intronic
908799706 1:67866501-67866523 CAGATTCTACAGATTACATATGG + Intergenic
909015244 1:70373296-70373318 GAGATTAAACAGAAGACACAAGG - Intronic
909106113 1:71411212-71411234 AAGATTCAGCAAAATACAAAAGG - Intronic
910076223 1:83282336-83282358 CAATTTCAGCAGTAGACAAATGG + Intergenic
911370049 1:96985853-96985875 CAGATTCATCCCATGACATATGG + Intergenic
911864932 1:103006464-103006486 CAGATAAAGCAGAAGACAAAAGG + Intronic
912716254 1:111985817-111985839 CAGATGCTGCAGAAGACAATAGG + Intronic
912943923 1:114069065-114069087 CAGTTTGTGCAGAAGACAGATGG - Intergenic
916228279 1:162512457-162512479 AAGATTCAGCAGAAATGATAAGG + Intronic
916715496 1:167443645-167443667 CAGACTCAGCACAACACAAAGGG + Intronic
917081393 1:171260057-171260079 AAGATTGAGCAGAAGACACCAGG + Intronic
917679377 1:177350377-177350399 CAGATTCTGCTGAGAACATAGGG - Intergenic
918119033 1:181521511-181521533 CAGAGTCAGGAGAAGACAGGAGG + Intronic
919083095 1:192890150-192890172 CAGATTCAGCATAAGCCATTTGG - Intergenic
919359392 1:196571678-196571700 CAAATTCAGGGGAAGATATAGGG + Intronic
920079086 1:203359258-203359280 AAGCTGCAGCAAAAGACATAGGG - Intergenic
921579105 1:216874299-216874321 CAAATTCAGTAGGAGACATAGGG + Intronic
922135147 1:222817802-222817824 CAGATTCAGCAGAATGGACAGGG - Intergenic
922313551 1:224420276-224420298 CAGATTCTGGAGAATACATGAGG + Intronic
923167690 1:231382641-231382663 CAGAACCAGCAGGAGTCATAAGG - Intronic
1065379023 10:25070267-25070289 CACATTTAGGAGAAGAGATAAGG - Intergenic
1065404754 10:25351338-25351360 CAGCTTCAGCAGAAGGCAGTGGG + Intronic
1068045990 10:51886918-51886940 CAGATTCAACAAAATACAGATGG - Intronic
1068153359 10:53163191-53163213 CAAAGTGAGCAGAACACATATGG + Intergenic
1072533096 10:96337906-96337928 CATATTCAGCAAAAGCCATTTGG - Intronic
1072738951 10:97898056-97898078 CAGAATCTGCAGGACACATATGG - Intronic
1073024032 10:100472998-100473020 CAGATGCAGCAGAAAATGTAAGG - Intronic
1074809529 10:117089640-117089662 CAGAATGAGAAGAAAACATACGG + Intronic
1076325919 10:129622989-129623011 CAGATTGAGCAGCAGAGATTAGG - Intronic
1077212851 11:1381396-1381418 CACATTTAGCAGAAGACAGCTGG + Intergenic
1078515186 11:12015946-12015968 CAGGTTCACCAGAAGACCAAAGG + Intergenic
1079807140 11:24946676-24946698 CAGCTTCATTAGAAGACAAAAGG - Intronic
1080390909 11:31845603-31845625 AAGATTCAGCAGGTGTCATAAGG - Intronic
1081699533 11:45144406-45144428 CAGATGCAGCTGAGGACCTACGG + Intronic
1081738370 11:45421101-45421123 GAGATTCAACCGAAGACATCTGG + Intergenic
1085763533 11:79262393-79262415 CAGATTCAACAAAAAACATCTGG + Intronic
1087389193 11:97512942-97512964 CAGATACAGCAAAAGAAAGAAGG - Intergenic
1089077414 11:115749423-115749445 ATGTTTCACCAGAAGACATAGGG - Intergenic
1089195116 11:116689762-116689784 CACATTCAGGAGGAGACATTTGG - Intergenic
1090261521 11:125324389-125324411 TATATTCAGCAGAGGACATGTGG - Intronic
1090504996 11:127301516-127301538 CAGATTCTGCAAAAGACAATAGG + Intergenic
1092654228 12:10667884-10667906 CCAATTCAGCAGAAGGTATAGGG + Intronic
1093223654 12:16453974-16453996 AAAATTCAACACAAGACATAAGG + Intronic
1095349852 12:41196989-41197011 CAGATTGTGCATAAGTCATACGG - Intronic
1095591986 12:43914038-43914060 CAGATGCACCAGAGGAAATATGG - Intronic
1095626462 12:44320024-44320046 GAAATTCAGCAGAAGTCTTAGGG - Intronic
1095779544 12:46044280-46044302 CAGATAGAGATGAAGACATAAGG - Intergenic
1096995337 12:55834756-55834778 CAGATGGAGCAGAGGACATATGG + Intergenic
1097036330 12:56127023-56127045 CAGATGCAGCAGAAGAACTGGGG - Exonic
1097146065 12:56940093-56940115 AAGACTCTACAGAAGACATAGGG + Intergenic
1097151782 12:56984570-56984592 AAGACTCTACAGAAGACATAGGG + Intergenic
1098622999 12:72627634-72627656 CAGATTCACCAGTCTACATATGG + Intronic
1099595696 12:84662201-84662223 CAGATTCAGCATAAATCTTAAGG + Intergenic
1100525200 12:95412596-95412618 CTGATTCAGCACCAGACAGAAGG + Intergenic
1101293118 12:103391926-103391948 AAAATTCAGAAGAAAACATAAGG - Intronic
1102261733 12:111447268-111447290 CAGACTCAGCCCAGGACATAAGG + Intronic
1102608422 12:114089135-114089157 CAGAATGAGCAGGAGACATAAGG + Intergenic
1106768189 13:32936972-32936994 CAGCCTCAGCAGAACACATCTGG - Intergenic
1107385690 13:39906277-39906299 CAGATTCACTAGAAGATATAAGG + Intergenic
1109961098 13:69632297-69632319 CAGATAGATCAGGAGACATAAGG + Intergenic
1110056254 13:70976325-70976347 CAGATTCAACAAAGGAGATAAGG + Intergenic
1110633410 13:77736646-77736668 CAGATTCAGCAGAAGACATAAGG - Intronic
1110914244 13:81001554-81001576 CAGAATAAGCAGCAGACATTTGG - Intergenic
1111894184 13:94120313-94120335 AGGATTCAGCAGAAAACATTTGG + Intronic
1113710310 13:112459443-112459465 CAGAGTAAGCAGAAAACCTATGG - Intergenic
1119026308 14:71155648-71155670 CAGAATCAGCTGAAGGCATCAGG + Intergenic
1120489987 14:85165172-85165194 GAGATGCAGCAGAAGTCAGAGGG + Intergenic
1120495821 14:85233970-85233992 GAGAATCAGCAGAAGAAAAAAGG - Intergenic
1120633165 14:86916228-86916250 CAGATTCATCAGAAGGCCAAGGG - Intronic
1121033879 14:90682930-90682952 CTGATTCTACAGAAGACATAGGG + Intronic
1121888739 14:97569450-97569472 CAGATTGCCCAGAAGACATATGG - Intergenic
1124426094 15:29564422-29564444 CAAGTTAAGCAGAAGACAGATGG - Intronic
1127250799 15:57235659-57235681 CAGAATCAGGAGAAGGAATATGG - Intronic
1127502429 15:59567060-59567082 CAGATTCTGCAGAAGCCACCTGG + Intergenic
1128494725 15:68189319-68189341 CAGGTTTAACAGAAGAGATAAGG + Exonic
1129950046 15:79578011-79578033 CAGCTTCAGCTGAAGACTCAAGG + Intergenic
1131987669 15:98061393-98061415 CAGGCTCAGAAGAAGACAGAAGG - Intergenic
1132643905 16:990106-990128 GAGAAGCAGCAGAAGACACAGGG - Intergenic
1135507125 16:23048662-23048684 CAGATTCAGTAGGTGACAAAGGG + Intergenic
1135956808 16:26962777-26962799 CAGAGCCAGCAGATGAGATACGG - Intergenic
1136506388 16:30706446-30706468 GAGATTCAGAAAAAGAAATAAGG + Intronic
1138464979 16:57183005-57183027 CTCATTCAGTAAAAGACATAAGG + Intronic
1139630541 16:68229570-68229592 CAGTATCACCAGAAGACATTAGG - Exonic
1140988365 16:80182600-80182622 AACTTTCAGCAGAAAACATAGGG + Intergenic
1144333795 17:14250297-14250319 CTGATTCATCAGAACACATTTGG + Intergenic
1145103490 17:20096011-20096033 AAGATACAGCTGAAGACATCAGG - Intronic
1150185562 17:63177451-63177473 TAGATTGAGCAGAAAATATATGG + Intronic
1150623997 17:66829799-66829821 CAGATGGAGCAGAATACATCAGG - Intergenic
1150855423 17:68747636-68747658 TAGAGTGGGCAGAAGACATAAGG + Intergenic
1153355277 18:4127467-4127489 CAAATTCAGAAGAATACATCTGG + Intronic
1154992709 18:21611714-21611736 CAGAATCAGCATAAGACTTTGGG + Intergenic
1157202261 18:45669086-45669108 CAACTTCAGAAGAAGATATAAGG - Intronic
1158751947 18:60272074-60272096 CAGATTGAAGAGAAGACATTGGG + Intergenic
1159150282 18:64514457-64514479 CAGCTTAGGTAGAAGACATATGG - Intergenic
1160044802 18:75376833-75376855 GAGATTCAGCAGCAGAGAGAGGG - Intergenic
1161610550 19:5240087-5240109 CAGAATCCGCAGCACACATAGGG + Intronic
1162147612 19:8622429-8622451 CAGATACAGCAGGAGACAGCAGG - Intergenic
1164438565 19:28253558-28253580 CACATGCAGCAGAAGAGAGAGGG - Intergenic
1166125221 19:40711176-40711198 AAGAGTCACCAGAAGACAGAGGG - Intronic
925058844 2:875790-875812 CAGACTCCGCAGAAGCCAGAGGG - Intergenic
926715516 2:15920841-15920863 CACATTCAGCAACAGACACACGG - Intergenic
926774769 2:16411066-16411088 TAGTTTCAACAGAAAACATATGG + Intergenic
928016306 2:27661125-27661147 CAGAATCAGCAGCAGACAGAAGG - Exonic
928177907 2:29047430-29047452 CAGAGTTAACAGAAGACCTATGG - Intronic
930558802 2:52933489-52933511 CAGAATCAACACAAGACAGAGGG + Intergenic
931244452 2:60480745-60480767 CCAATTCACCAGAAGACTTAAGG - Intronic
931951498 2:67368447-67368469 CATATTCAACAGAAGAATTAGGG + Intergenic
932792475 2:74667754-74667776 AAGAATGAGCAGAAGACAAAAGG - Intronic
935212409 2:100949900-100949922 CACAGTGAGCAGAAGACCTACGG - Intronic
935846071 2:107166879-107166901 CACATTGAGGAGACGACATATGG - Intergenic
936073949 2:109389909-109389931 CAGATTCAGGAGAAGGCAGATGG - Intronic
936500844 2:113065112-113065134 CAGATTCAGCTGAAGTCCTCAGG + Intronic
936650018 2:114414957-114414979 TACATCCAGGAGAAGACATATGG - Intergenic
936779460 2:116014687-116014709 CAGCTTGGACAGAAGACATATGG - Intergenic
936910359 2:117584618-117584640 CAGTTTCAGCATTATACATATGG - Intergenic
937653515 2:124347490-124347512 CAGATTGAGCAGAAGAAAGCTGG + Intronic
937678468 2:124618177-124618199 CAGATTCAACAGAATAGAAAAGG + Intronic
938148228 2:128856252-128856274 CAGATTCTGCAGATAATATAAGG - Intergenic
939748025 2:146002514-146002536 AAGAAACAGCAAAAGACATATGG - Intergenic
942874412 2:180776577-180776599 CAAATTCAGCATAAGAAAAATGG + Intergenic
943845642 2:192643177-192643199 CAGATTAGGCAGCAGACAAAAGG + Intergenic
944038396 2:195325652-195325674 CAGAGAAAGCAGAAGATATATGG + Intergenic
944093328 2:195939008-195939030 CAGATTAAGCAGATGATCTAAGG - Intronic
945406102 2:209451014-209451036 CATACCCAGCAGAAGAAATAAGG - Intronic
945904294 2:215574050-215574072 CAGATTCTGCACAAGACAGTTGG + Intergenic
946086164 2:217174673-217174695 CTGATAGAGGAGAAGACATAGGG - Intergenic
947252960 2:228128940-228128962 TAGATTTAGCATAATACATAGGG + Intronic
947900594 2:233718404-233718426 CACATTCAGCAGAGAACATGTGG + Intronic
948738032 2:240023031-240023053 CAGAGTCAGCACATGGCATAGGG - Intronic
1168804199 20:663123-663145 GAGATTCAGCAGAGGCCAGAGGG + Exonic
1169017522 20:2304058-2304080 CAGACTGTGCAGAAGACATAAGG + Intronic
1170681414 20:18529144-18529166 AAGATTAAGCTGAAGACACATGG + Intronic
1170845240 20:19956740-19956762 CAGACTCAGCTGCAGCCATATGG - Exonic
1170871469 20:20210328-20210350 CAGATGCAGAAGAACACATGGGG - Intronic
1171041756 20:21770640-21770662 CAGAGTGAACAGATGACATACGG - Intergenic
1172233546 20:33353462-33353484 CAGAATGAGCAAAAAACATAAGG + Intergenic
1177568076 21:22848872-22848894 GAAATTCTGCAGAAGACATTTGG + Intergenic
1180624052 22:17182161-17182183 CAGAGTCACAAGGAGACATAAGG + Intronic
1182790736 22:32950754-32950776 CAGATTTAGCAGAGGAACTAAGG + Intronic
1183096755 22:35556724-35556746 CAGGTTCAGCCGAAGGGATAGGG + Intergenic
1183096944 22:35557982-35558004 CAGGTTCAGCCGAAGGGATAGGG - Intergenic
1183358731 22:37372585-37372607 CAGATTTAGCATTAGACATCGGG - Exonic
952766101 3:36955629-36955651 CAGATTCAGCTGAAGTCATCAGG + Intergenic
952987535 3:38799375-38799397 CAAATTCTGCAGAACACATTGGG - Intergenic
956884862 3:73548837-73548859 CAGATGCTGGTGAAGACATAAGG + Intronic
958623440 3:96593561-96593583 CAGATGAAGCAGAACACCTAAGG - Intergenic
959132225 3:102370792-102370814 CAGATTCACAAGAATACATTAGG - Intronic
963338755 3:144008068-144008090 CAGATTCAAGGGAAGACAAATGG + Intronic
964802599 3:160572021-160572043 GAGACTCAGTAGAGGACATATGG - Intergenic
964928641 3:161988007-161988029 AAGAATCATCAGAAGACAGAAGG - Intergenic
964960946 3:162425351-162425373 TAGATTCATCAGAAAACAGATGG + Intergenic
966280148 3:178216855-178216877 CAGATTCAGCATTTGACCTATGG + Intergenic
966517396 3:180832903-180832925 CAGATTCAGACGAACACAGAAGG + Intronic
968495551 4:913458-913480 GAGATTCAGCAGAAGCAAAAGGG + Intronic
969058989 4:4420281-4420303 GAGATCCACCAGAAGACAAATGG + Intronic
969388779 4:6875123-6875145 CAGCCTCAGCAGAGGACACATGG + Intronic
971096458 4:23409911-23409933 CAGAATCAACAGAAGCCAGAAGG - Intergenic
972603463 4:40592840-40592862 CAGTTTCACAAGAAGAAATAAGG - Intronic
972706703 4:41551806-41551828 TAGATACAACAGAAAACATATGG + Intronic
976117714 4:81745626-81745648 CACATTCAGCAGTAAAGATATGG - Intronic
977464609 4:97368108-97368130 GAGATCCAGCAGAAGAGAAAGGG - Intronic
979686611 4:123517390-123517412 CAGAGTCTGTAGAAGACATAAGG + Intergenic
981193352 4:141889203-141889225 CACATTCAGCAAAAGATTTAGGG + Intergenic
981341585 4:143627950-143627972 CAGATTAAGCAGGAGGAATAGGG - Intronic
981600760 4:146485842-146485864 AAAATTCACCAGAAGAGATAAGG + Intronic
981889716 4:149720245-149720267 CAGAGTTAGCAGAAGAAAAATGG + Intergenic
983338938 4:166432895-166432917 CAGATGCAACAGAAACCATATGG - Intergenic
983467781 4:168116365-168116387 TAGATTCAGAAGAAGACAAATGG - Intronic
983751409 4:171277274-171277296 CAGGTTTAGCAAAAGACTTAAGG - Intergenic
984517522 4:180758850-180758872 CATATTAAGTAGAAGATATATGG - Intergenic
986170778 5:5312763-5312785 CAGACTCAGAAGAAAACAAAAGG - Intronic
987199653 5:15563090-15563112 CCTTTCCAGCAGAAGACATATGG - Intronic
989168747 5:38454910-38454932 AAGATTTAGCAGAAAAAATAAGG + Intronic
990067237 5:51733386-51733408 CAGATATAGCATAACACATATGG - Intergenic
990090297 5:52037675-52037697 CAGATTCAGTAGAGGAAATTGGG - Intronic
993504166 5:88691302-88691324 CAGATACATCAGAAGAGCTAAGG - Intergenic
995124385 5:108565603-108565625 CAGATTCAGAGGAAGAAAAATGG - Intergenic
997717819 5:136055225-136055247 AAGATACAGCAGAAGAGAGAAGG - Intronic
999890174 5:155969551-155969573 CACATTAGGCAGAAGACATGTGG + Intronic
1000030106 5:157394213-157394235 GAGATTCTGCAGAAGACTTTTGG - Intronic
1000204058 5:159040416-159040438 CAGCTTCAGAAGAAGAAAAAGGG - Intronic
1003174663 6:3745831-3745853 TAGACTCAGCAGAAAACACATGG - Intronic
1006896852 6:37476690-37476712 CAGAGTCAGGAGGAGACAGATGG + Intronic
1008942762 6:57064978-57065000 GAGCTTCAGCAGAAGTCATGAGG - Intergenic
1010132423 6:72509882-72509904 CAGAGTCAACAGAATACACATGG - Intergenic
1010241759 6:73622624-73622646 CAGATTCAGAGGTTGACATAAGG + Intronic
1012227022 6:96716364-96716386 CAGTTTCATAAGAAGAGATAGGG + Intergenic
1017154919 6:151314500-151314522 GTCATTCAGCAGAACACATATGG - Intronic
1017975347 6:159352385-159352407 GAGATTCAGCAGTGAACATAAGG + Intergenic
1019902283 7:4030313-4030335 CAGCTTACGCAGAAGACAGAGGG + Intronic
1020630455 7:10633160-10633182 CAGTTTCAGCTGAAGTGATATGG - Intergenic
1021489672 7:21205432-21205454 CAGATTGAGCAGAGGCCAGAGGG + Intergenic
1021587327 7:22223088-22223110 CAGAGTCATCAGAATACAGATGG + Intronic
1021594660 7:22302298-22302320 CTGTTTCAGCAGAAGCCATGTGG + Intronic
1021622323 7:22561103-22561125 CAGATTCCGCAGACTCCATAAGG + Intronic
1021732983 7:23614915-23614937 TAGATTCAGCATAATTCATAAGG + Intronic
1021816550 7:24452726-24452748 CAGATTCAGCAGAAGATACCAGG + Intergenic
1022329804 7:29366823-29366845 CACATTCAGCCAAAGACATTGGG + Intronic
1023048514 7:36231703-36231725 CAGAATCAGCAGAAGAAAGGCGG + Intronic
1023451667 7:40292621-40292643 CAGACTTAGCAGAAGGCAAAAGG - Intronic
1023631362 7:42167273-42167295 CAGATTAAGGACAAGACAAATGG + Intronic
1024385095 7:48741893-48741915 CAGAATCAGCAGATGCCCTAGGG + Intergenic
1026293416 7:69029240-69029262 CAGAGTCAGCTGAAGAGAGATGG - Intergenic
1026440098 7:70436889-70436911 CATATTCAGATGAAGACAAATGG + Intronic
1027293997 7:76747513-76747535 CAATTTCAGCAGTAGACAAATGG + Intergenic
1029094990 7:98077993-98078015 CTGATTCAGCAGCAGCTATAGGG - Intergenic
1029788965 7:102822519-102822541 CAGATTTAGAAGAGGTCATAAGG - Intronic
1032924962 7:136593559-136593581 CATATTAAGCAGAAAACAAAGGG + Intergenic
1034004421 7:147453323-147453345 CTGAGACAGCAGAAGTCATAGGG - Intronic
1036383374 8:8254825-8254847 AAGATACAGCAGAAGAGAGATGG + Intergenic
1037620983 8:20563244-20563266 CAGATTCTGTAGCAGACAGAGGG - Intergenic
1041152600 8:54952308-54952330 CCGCTTCAGCAGTAGAAATAAGG + Intergenic
1041656807 8:60360703-60360725 CCCATTGTGCAGAAGACATAAGG - Intergenic
1042802911 8:72740292-72740314 CAGATTCAGAACAAGATTTATGG + Intronic
1043364052 8:79510771-79510793 CAGATTTAACAGAATACATTTGG + Intergenic
1044628782 8:94259850-94259872 CAGAGTCAGCAGAAGTCAAGTGG + Intronic
1045659254 8:104419590-104419612 CATTTTCATCAAAAGACATACGG - Intronic
1046054129 8:109059189-109059211 CAGATTCAGCAACATACATAGGG + Intergenic
1046634056 8:116652404-116652426 AAAATTTAGCAGAAGACAAAAGG + Intronic
1046656944 8:116905289-116905311 CAGCCTCAGCAGATGCCATAGGG + Intergenic
1048374103 8:133807135-133807157 CAGTTTCAGCATAAGCCAGATGG - Intergenic
1049468628 8:142765121-142765143 CAGCTGCAGCCGAAGCCATATGG - Exonic
1050890132 9:10814734-10814756 CTAAGTAAGCAGAAGACATAGGG - Intergenic
1053167667 9:35855993-35856015 CAGAGTCAGCAGAGTACAGAAGG + Intergenic
1053250440 9:36569895-36569917 TAGATTCAGCATAATTCATAAGG - Intergenic
1053753779 9:41281187-41281209 CATATTTAGCAAAAGACACAAGG - Intergenic
1054259302 9:62845547-62845569 CATATTTAGCAAAAGACACAAGG - Intergenic
1054332475 9:63774490-63774512 CATATTTAGCAAAAGACACAAGG + Intergenic
1055409869 9:76017612-76017634 CAAATTCAGCAGAGCAGATAAGG - Intronic
1056257495 9:84814956-84814978 CAGGTTCATCTAAAGACATAGGG + Intronic
1056338281 9:85599784-85599806 CAGATTCTTCAAAAGACATTTGG + Intronic
1056975680 9:91251029-91251051 CGGCTGCAGCAGAAGAGATAGGG + Intronic
1057930207 9:99186296-99186318 AAGATGCAGCTGAAGAAATATGG - Intergenic
1058727074 9:107814449-107814471 AAGATTCAGCAGAGGAGACAGGG + Intergenic
1059057427 9:110998887-110998909 TAGATTCAAAAGAAGGCATAAGG + Intronic
1059092932 9:111380477-111380499 CAGATTTAGCAGAATTCTTAAGG + Intronic
1059369582 9:113816522-113816544 CAGTGGCAGAAGAAGACATATGG - Intergenic
1059678430 9:116562820-116562842 CTGATTAAGCTGAAGACAGAGGG + Intronic
1059721266 9:116962272-116962294 CTGACTCTGCAGAAGACATAGGG - Intronic
1061263245 9:129491398-129491420 CGGAATCAGGAGAAGACAGAGGG + Intergenic
1202799478 9_KI270719v1_random:162801-162823 CATATTTAGCAAAAGACACAAGG + Intergenic
1186395346 X:9202765-9202787 CAGGTTCTCCAGAAGACCTAGGG + Intergenic
1195242933 X:102971212-102971234 CAAAGTTAGCAGAAGAAATAAGG + Intergenic
1195273603 X:103256441-103256463 GAGAGTCAGAAGAAGACAGAGGG + Intergenic
1196108868 X:111925076-111925098 CAGATATAGGAGAAGAAATATGG + Intronic
1197895157 X:131305148-131305170 TAGTTTCAGTAGAAGAAATAAGG + Intronic
1199804685 X:151286608-151286630 CATATGCAGAAGAATACATATGG - Intergenic
1199941802 X:152635124-152635146 CAGATTCAGTAGAAGCCATCAGG + Intergenic