ID: 1110634821

View in Genome Browser
Species Human (GRCh38)
Location 13:77754623-77754645
Sequence CAGTCCAAATACCATGCCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 122}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110634818_1110634821 22 Left 1110634818 13:77754578-77754600 CCTTTTCCTTCTTCGTTCAGTTT 0: 1
1: 0
2: 0
3: 56
4: 630
Right 1110634821 13:77754623-77754645 CAGTCCAAATACCATGCCTTTGG 0: 1
1: 0
2: 1
3: 6
4: 122
1110634819_1110634821 16 Left 1110634819 13:77754584-77754606 CCTTCTTCGTTCAGTTTACTCCT 0: 1
1: 0
2: 1
3: 34
4: 464
Right 1110634821 13:77754623-77754645 CAGTCCAAATACCATGCCTTTGG 0: 1
1: 0
2: 1
3: 6
4: 122
1110634820_1110634821 -4 Left 1110634820 13:77754604-77754626 CCTATTTACTTTTATAACACAGT 0: 1
1: 0
2: 1
3: 36
4: 379
Right 1110634821 13:77754623-77754645 CAGTCCAAATACCATGCCTTTGG 0: 1
1: 0
2: 1
3: 6
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110634821 Original CRISPR CAGTCCAAATACCATGCCTT TGG Intronic
901030139 1:6302385-6302407 CGGTCCAAAAACCAAGCGTTTGG + Intronic
901617662 1:10554623-10554645 CAGTCCAGATCTCATGCCTGGGG + Intronic
903479686 1:23644253-23644275 CCTTCCAAATGCCATGCCTCTGG + Intergenic
907070674 1:51531824-51531846 AAGTCCAACTACCAAGCCCTGGG + Intergenic
907945754 1:59135122-59135144 GACTCCAAATACCATGCTTGTGG - Intergenic
908333456 1:63095880-63095902 CAGTTCAAAAAACATTCCTTGGG + Intergenic
910897724 1:92085832-92085854 CAGACCCAACACCAGGCCTTTGG + Intronic
911612600 1:99972918-99972940 CAGTCCAAATAATTTGCCCTGGG + Intronic
916245301 1:162681768-162681790 AACTCCAAATGCCATGACTTTGG + Intronic
916412225 1:164557988-164558010 CAGTGGAAATACTAGGCCTTTGG + Intronic
922016849 1:221656856-221656878 CAGACCAAACACCAGGCCTGTGG - Intergenic
923028964 1:230231509-230231531 CAGTCCAAAGAGCTTGCGTTTGG + Intronic
1065874797 10:29988168-29988190 CACTCCAAATCCCATGACTTTGG + Intergenic
1066449928 10:35519684-35519706 CAGTGCAGAGACCATGTCTTCGG - Intronic
1067027297 10:42855555-42855577 CAGTTCTAATACCATGGCATAGG - Intergenic
1074744235 10:116515391-116515413 CAGTCCTAATACCATTGCCTTGG - Intergenic
1080142609 11:28941113-28941135 CAGGCCAAATATCATGCAGTGGG - Intergenic
1083061515 11:59877504-59877526 CAGTCCAACTAGCATGACATTGG - Intergenic
1084725862 11:70941536-70941558 CAATCCAAATGCCATCCCCTTGG - Intronic
1086924113 11:92621724-92621746 CAATTCAAATAACAGGCCTTAGG - Intronic
1088291162 11:108239084-108239106 ACCTCCAAATACCATCCCTTTGG - Intronic
1089400063 11:118159391-118159413 CAGTCCTAATGTCTTGCCTTGGG + Intergenic
1090542108 11:127718192-127718214 CAGTGCAAATCACATCCCTTTGG - Intergenic
1090651451 11:128810211-128810233 CATTCCATTTACCAGGCCTTGGG + Intronic
1091628239 12:2139037-2139059 CTGTGAAAATACCATGCATTTGG + Intronic
1095285869 12:40409564-40409586 CATTGCAAATACCATCCCCTAGG - Intronic
1098995461 12:77114387-77114409 CAGTCCTAATACAATCCTTTAGG - Intergenic
1108229395 13:48320416-48320438 CAGTCCAAATGGGAGGCCTTTGG - Intronic
1108343950 13:49525864-49525886 CAGTACAAATACCAAGAATTGGG + Intronic
1110088119 13:71408187-71408209 AAGTCTAGATACTATGCCTTGGG + Intergenic
1110488106 13:76070143-76070165 CAGTCCTAGCACCATGACTTTGG - Intergenic
1110634821 13:77754623-77754645 CAGTCCAAATACCATGCCTTTGG + Intronic
1115598182 14:34929228-34929250 CAGTCCAAATGCCATGTCTCAGG - Intergenic
1117403313 14:55377512-55377534 AAGTCCAAAGGCCATGTCTTTGG - Intronic
1117659766 14:57991556-57991578 CTGTCCTGACACCATGCCTTGGG - Intergenic
1119506496 14:75177213-75177235 CAGCCCAAATACCCTGCTATGGG - Intergenic
1122373679 14:101243772-101243794 ACCTCCTAATACCATGCCTTGGG + Intergenic
1122642815 14:103170555-103170577 CAGACCAAACACCAGGCCATGGG - Intergenic
1123426959 15:20180402-20180424 CAGTTCTAATACCATGGCATAGG - Intergenic
1123536190 15:21186911-21186933 CAGTTCTAATACCATGGCATAGG - Intergenic
1128629491 15:69249211-69249233 AAGTGCAAATACCCTGACTTGGG + Intronic
1130299038 15:82666290-82666312 CAGTCCAAATCCCAGGCCCCAGG - Intronic
1131199855 15:90387642-90387664 CTGTCCAAATTCCCTACCTTTGG - Intergenic
1131441666 15:92464286-92464308 CAGCCCGCATACCATGCCCTTGG + Exonic
1132115926 15:99136638-99136660 CACCCCCAATACCATCCCTTTGG + Exonic
1135231974 16:20716840-20716862 CAGACCCAATACCAGGCCGTGGG - Intronic
1136857339 16:33669433-33669455 CAGTTCTAATACCATGGCATAGG + Intergenic
1137918804 16:52464162-52464184 CATTCCACACACCAAGCCTTGGG - Exonic
1203118911 16_KI270728v1_random:1517925-1517947 CAGTTCTAATACCATGGCATAGG + Intergenic
1147760949 17:42797073-42797095 GAATCCATATGCCATGCCTTAGG + Intronic
1148142048 17:45335962-45335984 CGGTTCAGATACCATGCTTTTGG - Intergenic
1148730373 17:49831563-49831585 GAGTCCAAATCCCATACTTTTGG + Exonic
1151041864 17:70871945-70871967 CAGTCCACATACTATGGATTTGG - Intergenic
1155650549 18:28135514-28135536 GAGTGAAAATACCATACCTTAGG + Intronic
1157099107 18:44713298-44713320 CAGTCAAATAACTATGCCTTAGG - Intronic
1160242919 18:77136040-77136062 ATGTCCAAATACCATTCCCTGGG + Intergenic
1162373768 19:10293436-10293458 CCGCCCAAATACCACGCCCTAGG - Intronic
1168508531 19:56956046-56956068 GAATGCAAAGACCATGCCTTGGG - Intergenic
927372793 2:22376685-22376707 CATTCCAAATCTGATGCCTTGGG + Intergenic
931002747 2:57806620-57806642 CAGCACAAATGCCATGTCTTGGG - Intergenic
931581585 2:63781209-63781231 CAGTCCAAATGCCAGGACTTGGG + Intronic
936953508 2:118001940-118001962 CAGGCTACATACCATGGCTTTGG - Intronic
939722711 2:145674931-145674953 TAGTCCAAAAGCCAGGCCTTTGG - Intergenic
942427983 2:175879489-175879511 AACTCCAACTACCATGCCTAAGG + Intergenic
942595260 2:177586216-177586238 CGGTCTAAATATCAGGCCTTAGG + Intergenic
942902654 2:181141100-181141122 CACTCCAAAGATGATGCCTTTGG + Intergenic
944758370 2:202787637-202787659 CACTCCACATATCATGCCCTTGG + Intronic
948184802 2:236012553-236012575 CGGTACAAATACCATGCATGAGG - Intronic
948606892 2:239141490-239141512 CAGTGCAAATAACATGGCCTCGG - Intronic
1168730391 20:73437-73459 CATTTCAAATACAATGACTTAGG + Intergenic
1168862722 20:1057566-1057588 CAGACCAAGTACATTGCCTTAGG - Intergenic
1175202350 20:57286717-57286739 CAGCCCAAATCTCATGCCTCAGG - Intergenic
1178566566 21:33691874-33691896 CTTTCCAAATACCATGACCTTGG + Intronic
1180239125 21:46487912-46487934 CAGTCTGAATACCAGGCCTGAGG + Intronic
1181679072 22:24478900-24478922 TAGTCCAAATTCCAATCCTTAGG + Intergenic
952716624 3:36486456-36486478 CTGTCCAAAGACCATCCCCTTGG + Intronic
954124009 3:48518143-48518165 GAGCCCAAGGACCATGCCTTTGG - Exonic
957054490 3:75433571-75433593 CAGTTCAAATACCACCTCTTTGG + Intergenic
959214129 3:103428018-103428040 TAGTCCAAATCCCAGGACTTAGG - Intergenic
959589707 3:108064681-108064703 CACTCCAAATGTCATGTCTTTGG - Intronic
961888152 3:130109933-130109955 CAGTTCAAATGCCACGTCTTTGG + Intronic
967832860 3:193935734-193935756 CACCGCAAATTCCATGCCTTAGG + Intergenic
968037073 3:195556489-195556511 TAGTACAAACACTATGCCTTTGG - Intergenic
969756714 4:9154801-9154823 CAGTTCAAATGCCACCCCTTTGG - Intergenic
971529186 4:27662770-27662792 CAGACCCAATACCAGGCCGTGGG - Intergenic
973053900 4:45630347-45630369 CAGTCCAGATAGTATGCCATGGG + Intergenic
973122801 4:46543785-46543807 CAGTCAAAATACCATGGGATGGG - Intergenic
977407710 4:96620977-96620999 CAGGGCAAATACCATGTGTTTGG - Intergenic
978103863 4:104877084-104877106 CACTCCAAATACCATGACATTGG - Intergenic
978167150 4:105622972-105622994 CAGTCCAAATTCTATGCCTTTGG + Intronic
982044098 4:151424456-151424478 CATTCTAGATTCCATGCCTTTGG - Intronic
982356804 4:154478719-154478741 CAGTCCATATCCCATGCATGTGG - Intronic
994170390 5:96653211-96653233 CAGTCCAGATTCATTGCCTTGGG + Intronic
994651861 5:102539138-102539160 CATTCAAAATATCATGACTTTGG + Intergenic
998840205 5:146245146-146245168 GGGTCCAAATACAATGCCTCAGG - Intronic
1002844654 6:935856-935878 CAGCCCAAATTCCAGGTCTTGGG + Intergenic
1006668335 6:35713829-35713851 CTGTCCAACTACTAAGCCTTGGG + Intronic
1008288132 6:49679592-49679614 CCTTCCATATTCCATGCCTTAGG + Intergenic
1008814330 6:55545548-55545570 CAGTCCATATGTCATGCATTGGG + Intronic
1008939696 6:57033019-57033041 ATGTCCAAACACCATACCTTTGG + Intergenic
1010759427 6:79706007-79706029 CAGGCCTAATACTGTGCCTTTGG + Intergenic
1012652048 6:101766944-101766966 CAGTCTAAAGACAATCCCTTTGG - Intronic
1013510500 6:110840364-110840386 CAGTCCCAAGTCCAGGCCTTTGG + Intronic
1013659282 6:112278344-112278366 CAGTCCAAATCCCCTGCCAATGG + Intergenic
1015530451 6:134216613-134216635 CAATCCAAATACAATGTCTAGGG - Intronic
1017308006 6:152942134-152942156 AAGTCAAAATGCCATGCCTTTGG - Intergenic
1017790695 6:157796241-157796263 TAGTCCAAACACCATTCCGTTGG - Intronic
1018042583 6:159937955-159937977 CAGTCAAAACAGCATGCCATTGG + Intergenic
1019980299 7:4616636-4616658 TACTCCAAATACCAGTCCTTTGG - Intergenic
1021191204 7:17621694-17621716 CAGTCACCATACCATGCCTTTGG - Intergenic
1021782714 7:24121476-24121498 CAGACCTGATACCATGACTTTGG + Intergenic
1023859520 7:44209326-44209348 CACTCCAAATAACGTGGCTTTGG + Intronic
1024222896 7:47302350-47302372 AAGTCCAAATCCCATGCCAAGGG + Intronic
1032357652 7:131225380-131225402 CACTCCTAAAACCATGACTTTGG + Intronic
1038248830 8:25883979-25884001 AAGTCCAAATATGGTGCCTTGGG - Intronic
1044238472 8:89859108-89859130 CAGAGCAAATAACAGGCCTTTGG - Intergenic
1046316109 8:112503844-112503866 CAGCTCAAATACAATGCATTTGG - Exonic
1050644661 9:7706344-7706366 TGATCCAAATGCCATGCCTTGGG - Intergenic
1051467824 9:17400539-17400561 CAGGTCAAATAGCATGCCTATGG - Intronic
1052483128 9:29057724-29057746 CGGGCCAGATACCATGGCTTCGG + Intergenic
1055915996 9:81400829-81400851 AAGTCCTAACACCATCCCTTTGG + Intergenic
1059142188 9:111864128-111864150 CAGGCAAAATTCCATTCCTTTGG - Intergenic
1062231500 9:135484547-135484569 CAGTCCAAATGGGAGGCCTTTGG + Exonic
1185780229 X:2837418-2837440 CACTCCAAAGGCCATGCTTTGGG - Intronic
1186498172 X:10029094-10029116 GAGCCCAAATAACCTGCCTTAGG - Intronic
1186794337 X:13029991-13030013 AATTCCAAATGCCACGCCTTAGG + Intergenic
1186817406 X:13251527-13251549 CAGTCCAGATGCCATCTCTTAGG - Intergenic
1187721410 X:22154783-22154805 CAGTCCAAAGACAAAGCTTTGGG + Intronic
1199247119 X:145618383-145618405 AAGTTCAAAAACCAGGCCTTTGG - Intergenic
1201289831 Y:12412577-12412599 CACTCCAAAGGCCATGCTTTGGG + Intergenic