ID: 1110635978

View in Genome Browser
Species Human (GRCh38)
Location 13:77767442-77767464
Sequence GTAAACTTCCTGACTCCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 145}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110635978_1110635985 23 Left 1110635978 13:77767442-77767464 CCAAGAGGAGTCAGGAAGTTTAC 0: 1
1: 0
2: 0
3: 13
4: 145
Right 1110635985 13:77767488-77767510 GAAGTCAGTGTATCACACGGTGG 0: 1
1: 0
2: 0
3: 8
4: 67
1110635978_1110635981 -1 Left 1110635978 13:77767442-77767464 CCAAGAGGAGTCAGGAAGTTTAC 0: 1
1: 0
2: 0
3: 13
4: 145
Right 1110635981 13:77767464-77767486 CAATAACGGCAGAAGGCAAATGG 0: 3
1: 55
2: 1173
3: 2248
4: 4814
1110635978_1110635983 1 Left 1110635978 13:77767442-77767464 CCAAGAGGAGTCAGGAAGTTTAC 0: 1
1: 0
2: 0
3: 13
4: 145
Right 1110635983 13:77767466-77767488 ATAACGGCAGAAGGCAAATGGGG 0: 1
1: 5
2: 132
3: 820
4: 1711
1110635978_1110635980 -8 Left 1110635978 13:77767442-77767464 CCAAGAGGAGTCAGGAAGTTTAC 0: 1
1: 0
2: 0
3: 13
4: 145
Right 1110635980 13:77767457-77767479 AAGTTTACAATAACGGCAGAAGG 0: 1
1: 1
2: 66
3: 926
4: 5235
1110635978_1110635982 0 Left 1110635978 13:77767442-77767464 CCAAGAGGAGTCAGGAAGTTTAC 0: 1
1: 0
2: 0
3: 13
4: 145
Right 1110635982 13:77767465-77767487 AATAACGGCAGAAGGCAAATGGG 0: 1
1: 0
2: 101
3: 1420
4: 3511
1110635978_1110635988 28 Left 1110635978 13:77767442-77767464 CCAAGAGGAGTCAGGAAGTTTAC 0: 1
1: 0
2: 0
3: 13
4: 145
Right 1110635988 13:77767493-77767515 CAGTGTATCACACGGTGGGAGGG 0: 1
1: 1
2: 1
3: 19
4: 140
1110635978_1110635986 24 Left 1110635978 13:77767442-77767464 CCAAGAGGAGTCAGGAAGTTTAC 0: 1
1: 0
2: 0
3: 13
4: 145
Right 1110635986 13:77767489-77767511 AAGTCAGTGTATCACACGGTGGG 0: 1
1: 0
2: 1
3: 6
4: 70
1110635978_1110635987 27 Left 1110635978 13:77767442-77767464 CCAAGAGGAGTCAGGAAGTTTAC 0: 1
1: 0
2: 0
3: 13
4: 145
Right 1110635987 13:77767492-77767514 TCAGTGTATCACACGGTGGGAGG 0: 1
1: 0
2: 2
3: 7
4: 117
1110635978_1110635984 20 Left 1110635978 13:77767442-77767464 CCAAGAGGAGTCAGGAAGTTTAC 0: 1
1: 0
2: 0
3: 13
4: 145
Right 1110635984 13:77767485-77767507 GGGGAAGTCAGTGTATCACACGG 0: 2
1: 2
2: 23
3: 90
4: 485

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110635978 Original CRISPR GTAAACTTCCTGACTCCTCT TGG (reversed) Intergenic
903318767 1:22529116-22529138 GAAAACTTTCTGACTCTGCTTGG + Exonic
905825027 1:41020750-41020772 GGACACTCCCTGAGTCCTCTGGG - Exonic
907357301 1:53886736-53886758 TTAAACTTCCTCACTCCACAGGG + Intronic
907416676 1:54319161-54319183 GGATACTTCCTCACTTCTCTAGG - Intronic
913191404 1:116416265-116416287 GCAAACTCCCTGTCTCCTCAAGG + Intergenic
917656377 1:177130316-177130338 GTACACTTGCTCACTACTCTGGG - Intronic
918630856 1:186716504-186716526 GTAAAATACCTGGCTCCTCAGGG - Intergenic
920163361 1:204017101-204017123 ATAAACTTCCAAACTCCACTGGG - Intergenic
921024545 1:211264979-211265001 ATGAACTACCTGACTTCTCTAGG + Intronic
922496270 1:226060723-226060745 GAAAACTTCCTGAAGCCACTAGG + Intergenic
924546193 1:245029995-245030017 GTGTACTTCCTGAGGCCTCTGGG + Intronic
1063990849 10:11560966-11560988 TTAAGCTTTCTGACTCCTTTAGG - Intronic
1064198857 10:13267692-13267714 GTAAATTACTTGACTTCTCTGGG - Intergenic
1064214808 10:13391405-13391427 GTAAGTTTCCTGACGCCTCCCGG + Intergenic
1066340528 10:34528491-34528513 GGTAACTTCTTCACTCCTCTGGG + Intronic
1067803514 10:49376837-49376859 AGAAACTTCCTCCCTCCTCTGGG + Intronic
1076225112 10:128768312-128768334 GTAGACTCCCAGAGTCCTCTGGG - Intergenic
1076273833 10:129179414-129179436 GAAGACTTCCTGGCTCATCTGGG - Intergenic
1076797333 10:132804585-132804607 ATAAAATTACTGGCTCCTCTGGG + Intergenic
1077649358 11:3955981-3956003 GTGAAACTCCTGACTACTCTGGG - Intronic
1079569365 11:21923218-21923240 TTAAATTTCCTGACTGCTCTAGG + Intergenic
1085041201 11:73327344-73327366 GGAATCGTCCTGACTCCTGTAGG + Intronic
1085809375 11:79666815-79666837 GTAAATCTCTTAACTCCTCTTGG + Intergenic
1086938310 11:92767997-92768019 GTAAACTGCCTCTCTCTTCTTGG - Intronic
1088167573 11:106956875-106956897 GCAGACTTGCTGTCTCCTCTTGG - Intronic
1088714743 11:112539073-112539095 GTAAACCTTCTCTCTCCTCTGGG - Intergenic
1091899728 12:4135067-4135089 GAAACCTTCCTGCATCCTCTCGG + Intergenic
1092086292 12:5765200-5765222 GTTATCTTCCTGGCTCCTGTGGG - Intronic
1095323168 12:40854838-40854860 CTTGACTCCCTGACTCCTCTGGG - Intronic
1095450580 12:42326491-42326513 ACCGACTTCCTGACTCCTCTCGG - Intronic
1096556431 12:52406798-52406820 GGGAACTTCCTGACTCACCTAGG - Intergenic
1096819002 12:54219427-54219449 GTAAAATTCCTTAAGCCTCTTGG - Intergenic
1098926261 12:76352546-76352568 GTAAACTTACTGATTTCTGTGGG + Exonic
1099471343 12:83053103-83053125 GTAACCTTTCTTACTCCTTTAGG - Intronic
1099869963 12:88334625-88334647 ATGAACTCCCTGACTCATCTGGG - Intergenic
1100737333 12:97551215-97551237 CTAAACCTCCTTAGTCCTCTTGG + Intergenic
1101369126 12:104108802-104108824 GTAAACACCCTGACATCTCTAGG - Intergenic
1103984862 12:124760475-124760497 GTGAACGACCTGACTTCTCTGGG + Intergenic
1106024148 13:25941081-25941103 GAGAACTTTCTGACTCCTCCAGG + Intronic
1110252308 13:73394646-73394668 GAGGCCTTCCTGACTCCTCTGGG - Intergenic
1110635978 13:77767442-77767464 GTAAACTTCCTGACTCCTCTTGG - Intergenic
1113556661 13:111241211-111241233 GAAAACTGCCTGCGTCCTCTGGG + Intronic
1114351111 14:21852454-21852476 CGAAACTTCCTCACACCTCTTGG + Intergenic
1118716855 14:68566015-68566037 GTAAACTTGCTCCCTCTTCTTGG + Intronic
1119579411 14:75763520-75763542 GAAATCATCCTAACTCCTCTGGG - Intronic
1120256091 14:82121427-82121449 GTAAAATGTCTGACTACTCTGGG + Intergenic
1125089939 15:35778685-35778707 GTGAAGTTCCTGACTTCTCTTGG + Intergenic
1125153398 15:36559853-36559875 GTAAACTACTTAACTCCCCTGGG - Intergenic
1125314253 15:38414307-38414329 CTAAATTTCCTGACTCTTCTTGG + Intergenic
1127622916 15:60751691-60751713 GTTACCTTCCTGCATCCTCTCGG + Intronic
1131421796 15:92312525-92312547 GGAGACTTCCTGACTCTACTTGG - Intergenic
1133508778 16:6437976-6437998 GGAAACTGCCAGGCTCCTCTTGG + Intronic
1134099731 16:11443592-11443614 GTCTTCTTCCTGACACCTCTAGG - Intronic
1134812307 16:17178153-17178175 GCAAACTGCCTGTCTCCTCTCGG + Intronic
1136147759 16:28325544-28325566 GCAAACTTCCTGAGCCGTCTAGG + Intergenic
1138336224 16:56255233-56255255 GCAATCTTCCTTACTCCTCACGG + Intronic
1139356446 16:66369611-66369633 GGAGGCTTCCAGACTCCTCTGGG - Intronic
1140123499 16:72102617-72102639 TCAAACTTCCTCCCTCCTCTTGG - Intronic
1140145273 16:72300850-72300872 CTAAACTTGCTGATTCCTCCAGG + Intergenic
1142950611 17:3476322-3476344 GTACACTTCTTCACTGCTCTGGG - Exonic
1146893545 17:36524657-36524679 GTAAACCACCTGAACCCTCTGGG - Intronic
1148737183 17:49871394-49871416 ATAAACTCCCTCACTCCTCTAGG - Intergenic
1150841641 17:68612958-68612980 CTATAGTTCCTGACTCTTCTGGG - Intergenic
1151160391 17:72160098-72160120 GGAAACTTCTTAACTTCTCTGGG + Intergenic
1152098726 17:78288338-78288360 GGAAACTTCCTGACTTCTTGTGG - Intergenic
1153508591 18:5829284-5829306 GTAAACTTCCACAGTGCTCTAGG + Intergenic
1154272406 18:12931525-12931547 GGAAACTTCCTGAGCCCTTTGGG - Intergenic
1158245567 18:55428852-55428874 GTAAGCTTCCTGACTCTTACTGG + Intronic
1158849814 18:61484373-61484395 AAAAACTTCCTGACTCCTTGAGG + Intronic
1159010334 18:63053130-63053152 GTAAATTTCCTGGCTTCTCTAGG + Intergenic
1161728293 19:5943544-5943566 GTCAACTTCCTACCTTCTCTGGG - Intronic
1161935932 19:7372233-7372255 GTTGCCTTCCTGACTCCTCAAGG - Intronic
1162701787 19:12521260-12521282 GTAACCTTCCTGCCTCAGCTGGG + Intronic
1164661159 19:29969677-29969699 GAAAACATCCTGACTGTTCTTGG + Intronic
1165975620 19:39673728-39673750 GTAAATTTCCAGAATCCTCTAGG - Intergenic
1168447650 19:56435297-56435319 GGAGACTTCATCACTCCTCTTGG - Intronic
928634293 2:33227404-33227426 GTCAAATTCCTGATTGCTCTAGG - Intronic
930040772 2:47121241-47121263 CTAAACTCCCTGTCTCCTGTAGG - Intronic
930803752 2:55469502-55469524 GTAAGCTTCCTGAGGCCTCCTGG + Intergenic
932948828 2:76269386-76269408 CTACCCTTCCTGACTCATCTGGG + Intergenic
937806606 2:126152149-126152171 GTAAGCTTCCTGAGGCCTCCAGG - Intergenic
1170998562 20:21391247-21391269 GGAAACAGCCTGACTACTCTGGG + Intergenic
1173419068 20:42884530-42884552 GTAAAATTCCTGAGACATCTAGG + Intronic
1175123057 20:56731276-56731298 GGAAATTTCCTGACCCCTCCTGG + Intergenic
1176366441 21:6035732-6035754 CCAAACTTCCTGATTGCTCTCGG + Intergenic
1179118710 21:38521742-38521764 GTATAGTTCCTGTCTCCTCAGGG - Intronic
1179757076 21:43502813-43502835 CCAAACTTCCTGATTGCTCTCGG - Intergenic
1182874828 22:33682515-33682537 GAAATCTTCCTGACTCCTGCTGG + Intronic
949151605 3:774840-774862 GTGAACTTGCTGGCTCCTATAGG + Intergenic
952960837 3:38588301-38588323 GGAAACTTCCTCTCTCTTCTAGG + Intronic
954277649 3:49553209-49553231 CTAAACTGCCTGGCCCCTCTGGG - Intergenic
954575316 3:51672468-51672490 GAACACTTCCTGTCTCCTCAAGG - Intronic
956806033 3:72812445-72812467 TTTACCTTCCTTACTCCTCTCGG + Intronic
959941263 3:112084362-112084384 TTAATCTTCCTGACTCTGCTAGG + Intergenic
963313656 3:143735050-143735072 GAACACTTGCCGACTCCTCTGGG + Intronic
964423338 3:156528061-156528083 ATAAACTACCTGACTACTCGAGG - Intronic
966092184 3:176153237-176153259 CTAACCATCCTGACTCTTCTCGG + Intergenic
966985096 3:185172817-185172839 GGATGCTTCCTGACTCCCCTAGG - Intergenic
969348002 4:6581217-6581239 GTAACCTTCCTGACTCGGCCGGG - Intronic
969925161 4:10578540-10578562 CCAAACTTTCTGACTTCTCTTGG + Intronic
970079412 4:12263852-12263874 GTATTCCTCCTGACTCTTCTTGG + Intergenic
970155561 4:13138179-13138201 GTCCAGATCCTGACTCCTCTAGG + Intergenic
972346418 4:38196196-38196218 ATAAACTTCCCGTCTCCTCCAGG - Intergenic
973645114 4:52942535-52942557 GCAAATTACCTGACTTCTCTGGG + Intronic
973842051 4:54872396-54872418 GTAAACTTCCTGAGTCATGCTGG + Intergenic
974410174 4:61530743-61530765 GAAAACTTCCTCACTCTTATAGG + Intronic
974457537 4:62146721-62146743 GTGAAGTTCCTGAGGCCTCTCGG + Intergenic
975631455 4:76408137-76408159 GTGAAACTCCTGACTACTCTGGG - Intronic
977348826 4:95853540-95853562 CTTTACTTCCTAACTCCTCTGGG - Intergenic
980709593 4:136547386-136547408 TTAAACTTTCTAACTCCACTGGG - Intergenic
986200764 5:5576179-5576201 GGAAACTTCCTGACACCTCCAGG - Intergenic
988447940 5:31309735-31309757 GTAAGTTTCCTGAGGCCTCTCGG - Intronic
989051979 5:37330540-37330562 GTAAATTACTTGACTTCTCTGGG - Intronic
989463622 5:41729016-41729038 GTCAACTTTCTTACTCCTCTCGG - Intergenic
992071786 5:73155386-73155408 GAACTCTTCCTGCCTCCTCTTGG - Intergenic
992334067 5:75747305-75747327 GTCACTTTCGTGACTCCTCTAGG + Intergenic
993442067 5:87969356-87969378 CTAAACTTCATGACACCTTTAGG - Intergenic
994490797 5:100440911-100440933 GAAAACTTACTAACTCCACTGGG - Intergenic
1004533209 6:16473890-16473912 GGAAACTTCCTGAATTGTCTAGG + Intronic
1006653177 6:35568142-35568164 ATAAACTTCCTGACTGTTCTGGG - Intergenic
1008154634 6:47998607-47998629 GTAATTTTCCTGACTCCTTAAGG - Intronic
1008358154 6:50580316-50580338 GTAAATTTTCTGACTGCTGTGGG + Intergenic
1008469396 6:51866277-51866299 GGAAACTTCCTCAGTCATCTAGG - Intronic
1009648500 6:66441893-66441915 GTAAACTACATGACTGCTCTGGG - Intergenic
1011030879 6:82921320-82921342 GAAAAATTCCTGAAGCCTCTTGG + Intronic
1011781647 6:90796397-90796419 GTTACCTTCCTGACTCCGGTAGG - Intergenic
1012107113 6:95176671-95176693 GAAGATTTTCTGACTCCTCTCGG - Intergenic
1012517100 6:100074565-100074587 GTAACTTTCCTGACTACTTTAGG - Intergenic
1013598744 6:111684616-111684638 CTTCACTTCCTGGCTCCTCTAGG - Intronic
1013751009 6:113406208-113406230 GTAAACATCCCTATTCCTCTGGG - Intergenic
1015408206 6:132861439-132861461 GTAAGGTTCCTGAGTACTCTAGG - Intergenic
1017533793 6:155325683-155325705 GTAAAATTACAGACTCCTGTTGG - Intergenic
1022529319 7:31057278-31057300 GTGCACTCCCTGACTCCTCCAGG + Intronic
1023316080 7:38938671-38938693 GTCCACTGCCTGACCCCTCTGGG - Intergenic
1023532171 7:41169427-41169449 GTAAACTTCCTGAAGCCGGTGGG - Intergenic
1030474018 7:110005257-110005279 GTAAGTTTCCTGAGGCCTCTGGG - Intergenic
1033875823 7:145817574-145817596 ATCTACTGCCTGACTCCTCTTGG - Intergenic
1034699483 7:153083889-153083911 GTAAGCTTCCTGACTCACCCCGG - Intergenic
1040655252 8:49500364-49500386 GTGAAAATCCTGACTCCACTTGG + Intergenic
1041134110 8:54737518-54737540 GATAACTTCCTGCTTCCTCTGGG + Intergenic
1041743874 8:61184809-61184831 GAGTACTTCCTTACTCCTCTAGG - Intronic
1043441459 8:80280128-80280150 GTTATATTCCTGACTTCTCTTGG + Intergenic
1044862594 8:96537430-96537452 GAGAACTTTATGACTCCTCTTGG - Intronic
1046212481 8:111096021-111096043 TTAAACTTTTTAACTCCTCTTGG - Intergenic
1046246634 8:111572281-111572303 AGCAATTTCCTGACTCCTCTAGG + Intergenic
1048638182 8:136322876-136322898 GAAAACTTCCTGTCTTTTCTGGG + Intergenic
1053007558 9:34614156-34614178 CTAAACTTCCTGCCTCATCACGG + Intronic
1055523003 9:77100969-77100991 GTAAGCTTCCTGAGGCCTCCTGG + Intergenic
1057066200 9:92054419-92054441 GAAAGCTTCCTGATGCCTCTTGG - Intronic
1186607244 X:11105168-11105190 ATGAAATTCCTCACTCCTCTAGG + Intergenic
1188315064 X:28663190-28663212 GTAAACTTCCTGCCACCTTTAGG - Intronic
1189254436 X:39626987-39627009 GTAAACTCCCTGGCACTTCTAGG - Intergenic
1189615088 X:42774887-42774909 TTAAATTTCATGTCTCCTCTAGG + Intergenic
1190072635 X:47291614-47291636 GAAAACTACCCGACCCCTCTGGG - Intergenic
1191734386 X:64373920-64373942 GAAAACTTCCTGAGTCCATTTGG - Intronic
1194262286 X:91711111-91711133 AATACCTTCCTGACTCCTCTAGG - Intergenic
1197133522 X:123033901-123033923 GTAAACTTCTTGTCTCCTTTGGG - Intergenic
1199137540 X:144270867-144270889 GTAAGTTTCCTGAGGCCTCTCGG - Intergenic
1200581580 Y:4955944-4955966 AATACCTTCCTGACTCCTCTAGG - Intergenic